Mature miRNA: hsa-miR-873-3p

Mature miRNA

miRNA Name hsa-miR-873-3p
miRNA Sequence 5' - ggagacugaugaguucccggga - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0022717

Precursor miRNA

Precursor Name hsa-mir-873
Genomic Location chr9:28888879-28888955 (-); nearby genomic features
NCBI GENE ID 100126316
MIM ID 616137
miRBase ID MI0005564
Precursor Sequence 
--   u ca   g a      ug g        a  ga
  gug g  uuu c ggaacu  u agucuccu uu  a
  ||| |  ||| | ||||||  | |||||||| ||   a
  cac c  aag g ccuuga  a ucagagga aa  a
aa   c ac   g c      gu g        c  gu

References

  • The novel miR-873-5p-YWHAE-PI3K/AKT axis is involved in non-small cell lung cancer progression and chemoresistance by mediating autophagy. Li Z, Liu J, Wang P, Zhang B, He G, Yang L. Funct Integr Genomics. 2024 Feb 16;24(2):33.

  • ERVK13-1/miR-873-5p/GNMT Axis Promotes Metastatic Potential in Human Bladder Cancer though Sarcosine Production. Kishi S, Mori S, Fujiwara-Tani R, Ogata R, Sasaki R, Ikemoto A, Goto K, Sasaki T, Miyake M, Sasagawa S, Kawaichi M, Luo Y, Bhawal UK, Fujimoto K, Nakagawa H, Kuniyasu H. Int J Mol Sci. 2023 Nov 15;24(22):16367.

  • Circ_0005615 Regulates the Progression of Colorectal Cancer Through the miR-873-5p/FOSL2 Signaling Pathway. Yu L, Zhang F, Wang Y. Biochem Genet. 2023 Oct;61(5):2020-2041.

  • Circ_MBNL3 Restrains Hepatocellular Carcinoma Progression by Sponging miR-873-5p to Release PHF2. Peng L, Chen J, Li M, Wang R. Biochem Genet. 2023 Jun;61(3):1015-1034.

  • Silencing of UCA1 attenuates the ox-LDL-induced injury of human umbilical vein endothelial cells via miR-873-5p/MAPK8 axis. Zhang SX, Yu CH. Kaohsiung J Med Sci. 2023 Jan;39(1):6-15.

  • Long non-coding RNA ERVK13-1 aggravates osteosarcoma through the involvement of microRNA-873-5p/KLF5 axis. Xie H, Dai L, Ye B, Chen R, Wang B, Zhang N, Miao H, Liang W. Acta Biochim Pol. 2022 Oct 22;69(4):703-710.

  • Circular RNA circTTBK2 facilitates non-small-cell lung cancer malignancy through the miR-873-5p/TEAD1/DERL1 axis. Wei JY, Zhang Q, Yao Y, He HB, Sun CH, Dong TT, Meng GP, Zhang J. Epigenomics. 2022 Aug;14(16):931-949.

  • MicroRNA-873-5p suppresses cell malignant behaviors of thyroid cancer via targeting CXCL5 and regulating P53 pathway. Chang W, Chang Q, Lu H, Liu S, Li Y, Chen C. Hum Vaccin Immunother. 2022 Nov 30;18(5):2065837.

  • Hsa_circ_0058129 regulates papillary thyroid cancer development via miR-873-5p/follistatin-like 1 axis. Tan X, Zhao J, Lou J, Zheng W, Wang P. J Clin Lab Anal. 2022 May;36(5):e24401.

  • Exposure to High-Altitude Environment Is Associated with Drug Transporters Change: microRNA-873-5p-Mediated Alteration of Function and Expression Levels of Drug Transporters under Hypoxia. Duan Y, Bai X, Yang J, Zhou Y, Gu W, Liu G, Wang Q, Zhu J, La L, Li X. Drug Metab Dispos. 2022 Feb;50(2):174-186.

  • LncRNA FGD5-AS1 functions as an oncogene to upregulate GTPBP4 expression by sponging miR-873-5p in hepatocellular carcinoma. Zhang N, Shen H, Huang S, Wang F, Liu H, Xie F, Jiang L, Chen X. Eur J Histochem. 2021 Nov 16;65(4):3300.

  • MiR-873-5p modulates progression of tongue squamous cell carcinoma via targeting SEC11A. Yao Y, Liu XQ, Yang FY, Mu JW. Oral Dis. 2022 Sep;28(6):1509-1518.

  • LINC00941 promotes proliferation and metastasis of pancreatic adenocarcinoma by competitively binding miR-873-3p and thus upregulates ATXN2. Fang L, Wang SH, Cui YG, Huang L. Eur Rev Med Pharmacol Sci. 2021 Feb;25(4):1861-1868.

  • CircZKSCAN1 Suppresses Hepatocellular Carcinoma Tumorigenesis by Regulating miR-873-5p/Downregulation of Deleted in Liver Cancer 1. Li J, Bao S, Wang L, Wang R. Dig Dis Sci. 2021 Dec;66(12):4374-4383.

  • Mining miRNAs' Expressions in Glioma Based on GEO Database and Their Effects on Biological Functions. Li K, Zhang Q, Niu D, Xing H. Biomed Res Int. 2020 Oct 10;2020:5637864.

  • TRIM29 inhibits miR-873-5P biogenesis via CYTOR to upregulate fibronectin 1 and promotes invasion of papillary thyroid cancer cells. Wu T, Zhang DL, Wang JM, Jiang JY, Du X, Zeng XY, Du ZX. Cell Death Dis. 2020 Sep 29;11(9):813.

  • The tumor-suppressive role of microRNA-873 in nasopharyngeal carcinoma correlates with downregulation of ZIC2 and inhibition of AKT signaling pathway. Lv B, Li F, Liu X, Lin L. Cancer Gene Ther. 2021 Feb;28(1-2):74-88.

  • Astrocyte-derived exosomes enriched with miR-873a-5p inhibit neuroinflammation via microglia phenotype modulation after traumatic brain injury. Long X, Yao X, Jiang Q, Yang Y, He X, Tian W, Zhao K, Zhang H. J Neuroinflammation. 2020 Mar 19;17(1):89.

  • Long non-coding RNA DDX11-AS1 facilitates gastric cancer progression by regulating miR-873-5p/SPC18 axis. Ren Z, Liu X, Si Y, Yang D. Artif Cells Nanomed Biotechnol. 2020 Dec;48(1):572-583.

  • MiR-873, as a suppressor in cervical cancer, inhibits cells proliferation, invasion and migration via negatively regulating ULBP2. Liang HX, Li YH. Genes Genomics. 2020 Apr;42(4):371-382.

    • There are 48 references associated with hsa-miR-873-3p. Click here to see the complete list in PubMed.