Mature miRNA: hsa-miR-671-3p

Mature miRNA

miRNA Name hsa-miR-671-3p
miRNA Sequence 5' - uccgguucucagggcuccacc - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004819

Precursor miRNA

Precursor Name hsa-mir-671
Genomic Location chr7:151238421-151238538 (+); nearby genomic features
NCBI GENE ID 768213
MIM ID 615245
miRBase ID MI0003760
Precursor Sequence 
   ggu aa     ----a    a        a   a      ga           -u   g
gca   g  cuggc     ggcc ggaagagg gga gcccug  ggggcuggagg  gau g
|||   |  |||||     |||| |||||||| ||| ||||||  |||||||||||  ||| 
cgu   c  gaccg     ccgg cuuucucc ccu cgggac  ucuuggccucc  uug a
   ggu gg     agaug    g        a   -      --           uu   u

References

  • MicroRNA-671-5p regulates the inflammatory response of periodontal ligament stem cells via the DUSP8/p38 MAPK pathway. Wang S, Ren Y, Li J, Li H, Li J, Lan X, Wang Y. Mol Biol Rep. 2024 May 10;51(1):644.

  • CircHDAC9 regulates myocardial ischemia-reperfusion injury via miR-671-5p/SOX4 signaling axis. Liu Q, Hu Y, Jie H, Lu W, Chen Y, Xing X, Tang B, Xu G, Sun J, Liang Y. Am J Med Sci. 2024 Jan;367(1):49-60.

  • MiR-766-3p and miR-671-5p attenuate aristolochic acid-induced hepatotoxicity by directly targeting the key bioactivating enzyme NQO1. Liu Y, Guan H, Feng M, Du C, Zhang Q, Shou Y, Qi G, Yu D, Jin Y. Ecotoxicol Environ Saf. 2023 Aug;261:115103.

  • Circular RNA circARHGEF28 inhibited the progression of prostate cancer via the miR-671-5p/LGALS3BP/NF-κB axis. Guo K, Shi J, Tang Z, Lai C, Liu C, Li K, Li Z, Xu K. Cancer Sci. 2023 Jul;114(7):2907-2919.

  • The molecular mechanism of γ-aminobutyric acid against AD: the role of CEBPα/circAPLP2/miR-671-5p in regulating CNTN1/2 expression. Meng N, Pan P, Hu S, Miao C, Hu Y, Wang F, Zhang J, An L. Food Funct. 2023 Feb 21;14(4):2082-2095.

  • Extracellular vesicle-transmitted miR-671-5p alleviates lung inflammation and injury by regulating the AAK1/NF-κB axis. Lian J, Zhu X, Du J, Huang B, Zhao F, Ma C, Guo R, Zhang Y, Ji L, Yahaya BH, Lin J. Mol Ther. 2023 May 3;31(5):1365-1382.

  • lncRNA DLEU1 Modulates Proliferation, Inflammation, and Extracellular Matrix Degradation of Chondrocytes through Regulating miR-671-5p. Wu X, Yin S, Yan L, Liu Y, Shang L, Liu J. J Immunol Res. 2022 May 18;2022:1816217.

  • LncRNA-PACERR induces pro-tumour macrophages via interacting with miR-671-3p and m6A-reader IGF2BP2 in pancreatic ductal adenocarcinoma. Liu Y, Shi M, He X, Cao Y, Liu P, Li F, Zou S, Wen C, Zhan Q, Xu Z, Wang J, Sun B, Shen B. J Hematol Oncol. 2022 May 7;15(1):52.

  • Circ_0001947 promotes cell proliferation, invasion, migration and inflammation and inhibits apoptosis in human rheumatoid arthritis fibroblast-like synoviocytes through miR-671-5p/STAT3 axis. Yang Y, Lin S, Yang Z, Huang Y, Zhan F. J Orthop Surg Res. 2022 Jan 29;17(1):54.

  • [MiR-671-5p negatively regulates SMAD3 to inhibit migration and invasion of osteosarcoma cells]. Hu Y, Liang D, Chen X, Chen L, Bai J, Li H, Yin C, Zhong W. Nan Fang Yi Ke Da Xue Xue Bao. 2021 Oct 20;41(10):1562-1568.

  • miR-671-5p repressed progression of papillary thyroid carcinoma via TRIM14. Wang WJ, Yuan Y, Zhang D, Liu P, Liu F. Kaohsiung J Med Sci. 2021 Nov;37(11):983-990.

  • miR-720 is a key regulator of glioma migration and invasion by controlling TARSL2 expression. Liu Y, Jiang K, Zhi T, Xu X. Hum Cell. 2021 Sep;34(5):1504-1516.

  • Circ_0114876 promoted IL-1β-induced chondrocyte injury by targeting miR-671/TRAF2 axis. Wang Q, Luo S, Yang J, Li J, Huan S, She G, Zha Z. Biotechnol Lett. 2021 Apr;43(4):791-802.

  • circSLC8A1 sponges miR-671 to regulate breast cancer tumorigenesis via PTEN/PI3k/Akt pathway. Zhu Q, Zhang X, Zai HY, Jiang W, Zhang KJ, He YQ, Hu Y. Genomics. 2021 Jan;113(1 Pt 1):398-410.

  • MiRNA-671-5p Promotes prostate cancer development and metastasis by targeting NFIA/CRYAB axis. Zhu Z, Luo L, Xiang Q, Wang J, Liu Y, Deng Y, Zhao Z. Cell Death Dis. 2020 Nov 3;11(11):949.

  • Guizhi Fuling pills inhibit the proliferation, migration and invasion of human cutaneous malignant melanoma cells by regulating the molecular axis of LncRNA TPT1-AS1 / miR-671-5p. Zhang B. Cell Mol Biol (Noisy-le-grand). 2020 Jul 31;66(5):148-154.

  • [MicroRNA-671-3p suppresses proliferation and invasion of breast cancer cells by targeting DEPTOR]. Xia W, Gong D, Qin X, Cai Z. Nan Fang Yi Ke Da Xue Xue Bao. 2020 Jan 30;40(1):42-48.

  • MiR-671-5p plays a promising role in restraining osteosarcoma cell characteristics through targeting TUFT1. Ma C, Nie ZK, Guo HM, Kong Y. J Biochem Mol Toxicol. 2020 Jul;34(7):e22490.

  • Exosomal miR-146a-5p from Treponema pallidum-stimulated macrophages reduces endothelial cells permeability and monocyte transendothelial migration by targeting JAM-C. Hu W, Xu B, Zhang J, Kou C, Liu J, Wang Q, Zhang R. Exp Cell Res. 2020 Mar 1;388(1):111823.

  • HMGA1-mediated miR-671-5p targets APC to promote metastasis of clear cell renal cell carcinoma through Wnt signaling. Chi XG, Meng XX, Ding DL, Xuan XH, Chen YZ, Cai Q, Wang A. Neoplasma. 2020 Jan;67(1):46-53.

    • There are 44 references associated with hsa-miR-671-3p. Click here to see the complete list in PubMed.