Mature miRNA: hsa-miR-665

Mature miRNA

miRNA Name hsa-miR-665
miRNA Sequence 5' - accaggaggcugaggccccu - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004952

Precursor miRNA

Precursor Name hsa-mir-665
Genomic Location chr14:100875033-100875104 (+); nearby genomic features
Clustered miRNAs hsa-mir-493,hsa-mir-337,hsa-mir-665,hsa-mir-431,hsa-mir-433,hsa-mir-127,hsa-mir-432,hsa-mir-136 (within 10kb in genome)
NCBI GENE ID 100126315
miRBase ID MI0005563
Precursor Sequence 
-  u   -c          u      -acc  g  c
 uc ccu  gaggggucuc gccucu    ca ga u
 || |||  |||||||||| ||||||    || ||  c
 gg gga  cuccccggag cggagg    gu cu u
c  c   ca          u      acca  a  u

References

  • Circular RNA circESYT2 serves as a microRNA-665 sponge to promote the progression of hepatocellular carcinoma through ENO2. Du W, Li Y, Wang X, Xie S, Ci H, Zhou J, Zhu N, Chen Z, Zheng Y, Jia H. Cancer Sci. 2024 Aug;115(8):2659-2672.

  • circSNTB2 and CUL4A Induces Dysfunction of Nucleus Pulposus Cells by Competitively Binding miR-665. Jia Y, Huo X, Wu L, Zhang H, Xu W, Leng H. Biochem Genet. 2024 Apr;62(2):968-986.

  • Circ_0104700 contributes to acute myeloid leukemia progression by enhancing MCM2 expression through targeting miR-665. Chen K, Ning X, Yan X, Song L. Hematology. 2023 Dec;28(1):2227489.

  • Hsa_hsa_circ_0081069 promotes the progression of colorectal cancer through sponging miR-665 and regulating E2F3 expression. Xie J, Jin D, Xu J, Yang F, Jin J. J Clin Lab Anal. 2022 Nov;36(11):e24710.

  • Sevoflurane Inhibits Metastasis in Hepatocellular Carcinoma by Inhibiting MiR-665-Induced Activation of the ERK/MMP Pathway. Zhu X, Peng C, Peng Z, Chang R, Guo Q. Cell Transplant. 2022 Jan-Dec;31:9636897221104447.

  • Circ_ARHGAP32 acts as miR-665 sponge to upregulate FGF2 to promote ox-LDL induced vascular smooth muscle cells proliferation and migration. Wang Y, Pei W, Lu P. Clin Hemorheol Microcirc. 2022;82(2):169-182.

  • Hsa_circ_0010729 is Involved in Oxygen-Glucose Deprivation/Reoxygenation-Induced Human Microvascular Endothelial Cell Deprivation by Targeting miR-665/ING5. Ouyang X, Shi G, Wang S, Chen L, Xu J, Xie D. Biochem Genet. 2022 Dec;60(6):2455-2470.

  • LncRNA RPSAP52 promotes cell proliferation and inhibits cell apoptosis via modulating miR-665/STAT3 in gastric cancer. He C, Liu Y, Li J, Zheng X, Liang J, Cui G, Chang H. Bioengineered. 2022 Apr;13(4):8699-8711.

  • Circ_0101802 Facilitates Colorectal Cancer Progression Depending on the Regulation of miR-665/DVL3 Signaling. Li J, Liu X, Dong S, Liao H, Huang W, Yuan X. Biochem Genet. 2022 Dec;60(6):2250-2267.

  • MicroRNA-665-3p exacerbates nonalcoholic fatty liver disease in mice. Yu Y, Tian T, Tan S, Wu P, Guo Y, Li M, Huang M. Bioengineered. 2022 Feb;13(2):2927-2942.

  • Long non-coding RNA NHEG1/hsa-miR-665/HMGB1 axis is involved in the regulation of neuroblastoma progression. Zhang Y, Hu Y, Pan A, He L, Wang J, Zhou F, Lei Y, Wang Y. Bioengineered. 2021 Dec;12(2):11584-11596.

  • MiR-665 suppresses the progression of diffuse large B cell lymphoma (DLBCL) through targeting LIM and SH3 protein 1 (LASP1). Wang Y, Guo D, Li B, Wang Y, Wang B, Wang Z, Wang M, Teng Q. Leuk Res. 2022 Jan;112:106769.

  • Circ_0044556 Promotes the Progression of Colorectal Cancer via the miR-665-Dependent Expression Regulation of Diaphanous Homolog 1. Ma X, Deng C. Dig Dis Sci. 2022 Sep;67(9):4458-4470.

  • Circ_SPG11 plays contributing effects on IL-1β-induced chondrocyte apoptosis and ECM degradation via miR-665 inhibition-mediated GREM1 upregulation. Ouyang X, Ding Y, Yu L, Xin F, Yang X, Liu X, Tong S. Clin Immunol. 2021 Dec;233:108889.

  • RNF144A-AS1 promotes the development of glioma cells by targeting miR-665/HMGA1 axis. Tong X, Yang Z, Wang Q, Zhang D. Neurosci Lett. 2021 Nov 20;765:136259.

  • LncRNA MIAT regulates autophagy and apoptosis of macrophage infected by Mycobacterium tuberculosis through the miR-665/ULK1 signaling axis. Jiang F, Lou J, Zheng XM, Yang XY. Mol Immunol. 2021 Nov;139:42-49.

  • miR-665 inhibits epithelial-to-mesenchymal transition in bladder cancer via the SMAD3/SNAIL axis. Wang W, Ying Y, Xie H, Li J, Ma X, He L, Xu M, Chen S, Shen H, Zheng X, Liu B, Wang X, Xie L. Cell Cycle. 2021 Jul;20(13):1242-1252.

  • MicroRNA-665 Regulates Cell Proliferation and Apoptosis of Vascular Smooth Muscle Cells by Targeting TGFBR1. Wang L, Zhou J, Guo F, Yao T, Zhang L. Int Heart J. 2021 Mar 30;62(2):371-380.

  • MiR-665 inhibits inflammatory response in microglia following spinal cord injury by targeting TREM2. Liu S, Li XM, Yuan JB, Li LL, Wang C, Lin XM, Miao X, Shi ZC. Eur Rev Med Pharmacol Sci. 2021 Jan;25(1):65-70.

  • Circular RNA Paired-Related Homeobox 1 Promotes Gastric Carcinoma Cell Progression via Regulating MicroRNA-665/YWHAZ Axis. Liu W, Hu W, Hou K, Zhu S. Dig Dis Sci. 2021 Nov;66(11):3842-3853.

    • There are 44 references associated with hsa-miR-665. Click here to see the complete list in PubMed.