Mature miRNA: hsa-miR-625-3p

Mature miRNA

miRNA Name hsa-miR-625-3p
Previous Name hsa-miR-625*
miRNA Sequence 5' - gacuauagaacuuucccccuca - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004808

Precursor miRNA

Precursor Name hsa-mir-625
Genomic Location chr14:65471102-65471186 (+); nearby genomic features
NCBI GENE ID 693210
miRBase ID MI0003639
Precursor Sequence 
                                     uaau
aggguagagggaugagggggaaaguucuauaguccug    u
|||||||||||||||||||||||||||||||||||||     a
ucccgucucccuacucccccuuucaagauaucaggac    g
                                     ucua

References

  • MiR-625-5p is a potential therapeutic target in sepsis by regulating CXCL16/CXCR6 axis and endothelial barrier. Huang X, Fei Y, Qiu X, Qian T, Shang Q, Cui J, Song Y, Sheng S, Xiao W, Yu Q, Wang T, Wang X. Int Immunopharmacol. 2024 Aug 20;137:112508.

  • Novel Biomarker Yang T, Si Q, Liu M, DU R, Ji L, Zhang X, Su J, Sun H, Wang L, Zhao C, Liu J, Ouyang S, Dai L. Anticancer Res. 2023 Nov;43(11):4923-4935.

  • Splicing factor SNRPA associated with microvascular invasion promotes hepatocellular carcinoma metastasis through activating NOTCH1/Snail pathway and is mediated by circSEC62/miR-625-5p axis. Mo Z, Li R, Cao C, Li Y, Zheng S, Wu R, Xue J, Hu J, Meng H, Zhai H, Huang W, Zheng F, Zhou B. Environ Toxicol. 2023 May;38(5):1022-1037.

  • Exosomal mir-625-3p derived from hypoxic lung cancer cells facilitates metastasis by targeting SCAI. Zhang Y, Qian K, Liu X, Zhao X, Zhao T, Lu G. Mol Biol Rep. 2022 Oct;49(10):9275-9281.

  • Functional roles of miR-625-5p and miR-874-3p in the progression of castration resistant prostate cancer. Aktan Ç, Çal Ç, Kaymaz B, Selvi Günel N, Kıpçak S, Özel B, Gündüz C, Åžahin Küçükaslan A, AygüneÅŸ Jafari D, Kosova B. Life Sci. 2022 Jul 15;301:120603.

  • Hsa-miR-625 Upregulation Promotes Apoptosis in Acute Myeloid Leukemia Cell Line by Targeting Integrin-linked Kinase Pathway. Aliabedi B, Mousavi SH, Ebrahimi M, Alizadeh S, Hedayati Asl AA, Mohammad M, Samieyan Dehkordi S. Asian Pac J Cancer Prev. 2022 Apr 1;23(4):1159-1167.

  • Insights into the identification of a molecular signature for amyotrophic lateral sclerosis exploiting integrated microRNA profiling of iPSC-derived motor neurons and exosomes. Rizzuti M, Melzi V, Gagliardi D, Resnati D, Meneri M, Dioni L, Masrori P, Hersmus N, Poesen K, Locatelli M, Biella F, Silipigni R, Bollati V, Bresolin N, Comi GP, Van Damme P, Nizzardo M, Corti S. Cell Mol Life Sci. 2022 Mar 14;79(3):189.

  • MicroRNA-625-3p improved proliferation and involved chemotherapy resistance via targeting PTEN in high grade ovarian serous carcinoma. Zhong L, Liu X, Wang L, Liu Y, Zhang D, Zhao Y. J Ovarian Res. 2022 Jan 14;15(1):7.

  • Circ-SNAP47 (hsa_circ_0016760) and miR-625-5p are regulators of WEE1 in regulation of chemoresistance, growth and invasion of DDP-tolerant NSCLC cells via ceRNA pathway. Zou C, Rong F, Zeng Y, Zeng J, Wei R, Wei D. Environ Toxicol. 2022 Feb;37(2):224-236.

  • Long non-coding RNA LINC00511 regulates the expression of microRNA-625-5p and activates signal transducers and activators of transcription 3 (STAT3) to accelerate the progression of gastric cancer. Cui N, Sun Q, Liu H, Li L, Guo X, Shi Y, Jing C, Qin C, Zhao Y. Bioengineered. 2021 Dec;12(1):2915-2927.

  • RBM24 exacerbates bladder cancer progression by forming a Runx1t1/TCF4/miR-625-5p feedback loop. Yin YW, Liu KL, Lu BS, Li W, Niu YL, Zhao CM, Yang Z, Guo PY, Qi JC. Exp Mol Med. 2021 May;53(5):933-946.

  • A functional SNP in miR-625-5p binding site of AKT2 3'UTR is associated with noise-induced hearing loss susceptibility in the Chinese population. Miao L, Wang B, Zhang J, Yin L, Pu Y. Environ Sci Pollut Res Int. 2021 Aug;28(30):40782-40792.

  • Long noncoding RNA LINC01291 promotes the aggressive properties of melanoma by functioning as a competing endogenous RNA for microRNA-625-5p and subsequently increasing IGF-1R expression. Wu L, Li K, Lin W, Liu J, Qi Q, Shen G, Chen W, He W. Cancer Gene Ther. 2022 Mar;29(3-4):341-357.

  • The enhancer activity of long interspersed nuclear element derived microRNA 625 induced by NF-κB. Lee HE, Park SJ, Huh JW, Imai H, Kim HS. Sci Rep. 2021 Feb 4;11(1):3139.

  • LncRNA LINC00511 plays an oncogenic role in lung adenocarcinoma by regulating PKM2 expression via sponging miR-625-5p. Xue J, Zhang F. Thorac Cancer. 2020 Sep;11(9):2570-2579.

  • LncRNA LINC00909 promotes cell proliferation and metastasis in pediatric acute myeloid leukemia via miR-625-mediated modulation of Wnt/β-catenin signaling. Ma L, Wang YY, Jiang P. Biochem Biophys Res Commun. 2020 Jun 30;527(3):654-661.

  • The miR‑625‑3p/AXL axis induces non‑T790M acquired resistance to EGFR‑TKI via activation of the TGF‑β/Smad pathway and EMT in EGFR‑mutant non‑small cell lung cancer. Du W, Sun L, Liu T, Zhu J, Zeng Y, Zhang Y, Wang X, Liu Z, Huang JA. Oncol Rep. 2020 Jul;44(1):185-195.

  • MicroRNA-625-5p Sponges lncRNA MALAT1 to Inhibit Cervical Carcinoma Cell Growth by Suppressing NF-κB Signaling. Li Y, Ding Y, Ding N, Zhang H, Lu M, Cui X, Yu X. Cell Biochem Biophys. 2020 Jun;78(2):217-225.

  • MicroRNA-625-3p inhibits gastric cancer metastasis through modulating EZH2. Li Y, Zhou HC, Zhang Y, Huang H. Eur Rev Med Pharmacol Sci. 2020 Feb;24(3):1177-1185.

  • Long noncoding RNA Wu Z, Wang W, Wang Y, Wang X, Sun S, Yao Y, Zhang Y, Ren Z. Cell Cycle. 2020 Mar;19(5):610-624.

    • There are 47 references associated with hsa-miR-625-3p. Click here to see the complete list in PubMed.