Mature miRNA: hsa-miR-619-5p

Mature miRNA

miRNA Name hsa-miR-619-5p
miRNA Sequence 5' - gcugggauuacaggcaugagcc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0026622
Similar miRNAs hsa-miR-6506-5p (sharing the same seed sequence with hsa-miR-619-5p).

Precursor miRNA

Precursor Name hsa-mir-619
Genomic Location chr12:108836908-108837006 (-); nearby genomic features
NCBI GENE ID 693204
miRBase ID MI0003633
Precursor Sequence 
-c  cc  -cu   ccucccaaaa       au          ag   cugc    ga
  gc  ac   cag          ugcuggg  uacaggcaug  cca    gguc  c
  ||  ||   |||          |||||||  ||||||||||  |||    ||||  
  cg  ug   guc          augaccc  guguuuguac  ggu    ccag  c
ga  uu  acu   ----------       --          -a   ----    ua

References

  • hsa_circRNA_BECN1 acts as a ceRNA to promote polycystic ovary syndrome progression by sponging the miR-619-5p/Rab5b axis. Fan H, Zhou D, Zhang X, Jiang M, Kong X, Xue T, Gao L, Lu D, Tao C, Wang L. Mol Hum Reprod. 2023 Nov 1;29(11):gaad036.

  • Circ-FAT1 Up-Regulates FOSL2 Expression by Sponging miR-619-5p to Facilitate Colorectal Cancer Progression. Ma W, Niu Z, Han D, Wang B, Wang X. Biochem Genet. 2022 Aug;60(4):1362-1379.

  • LncRNA BCYRN1 inhibits glioma tumorigenesis by competitively binding with miR-619-5p to regulate CUEDC2 expression and the PTEN/AKT/p21 pathway. Mu M, Niu W, Zhang X, Hu S, Niu C. Oncogene. 2020 Nov;39(45):6879-6892.

  • LncRNA PVT1 promotes gemcitabine resistance of pancreatic cancer via activating Wnt/β-catenin and autophagy pathway through modulating the miR-619-5p/Pygo2 and miR-619-5p/ATG14 axes. Zhou C, Yi C, Yi Y, Qin W, Yan Y, Dong X, Zhang X, Huang Y, Zhang R, Wei J, Ali DW, Michalak M, Chen XZ, Tang J. Mol Cancer. 2020 Jul 29;19(1):118.

  • Tumor-derived exosomal miR-619-5p promotes tumor angiogenesis and metastasis through the inhibition of RCAN1.4. Kim DH, Park S, Kim H, Choi YJ, Kim SY, Sung KJ, Sung YH, Choi CM, Yun M, Yi YS, Lee CW, Kim SY, Lee JC, Rho JK. Cancer Lett. 2020 Apr 10;475:2-13.

  • Exosomal miR-146a-5p from Treponema pallidum-stimulated macrophages reduces endothelial cells permeability and monocyte transendothelial migration by targeting JAM-C. Hu W, Xu B, Zhang J, Kou C, Liu J, Wang Q, Zhang R. Exp Cell Res. 2020 Mar 1;388(1):111823.

  • Long noncoding RNA SBF2-AS1 promotes colorectal cancer proliferation and invasion by inhibiting miR-619-5p activity and facilitating HDAC3 expression. Chen G, Gu Y, Han P, Li Z, Zhao JL, Gao MZ. J Cell Physiol. 2019 Aug;234(10):18688-18696.

  • Plasma Levels of hsa-miR-619-5p and hsa-miR-1184 Differ in Prostatic Benign Hyperplasia and Cancer. Knyazev EN, Fomicheva KA, Mikhailenko DS, Nyushko KM, Samatov TR, Alekseev BY, Shkurnikov MY. Bull Exp Biol Med. 2016 May;161(1):108-11.

  • The properties of binding sites of miR-619-5p, miR-5095, miR-5096, and miR-5585-3p in the mRNAs of human genes. Ivashchenko A, Berillo O, Pyrkova A, Niyazova R, Atambayeva S. Biomed Res Int. 2014;2014:720715.

  • The repertoire and features of human platelet microRNAs. Plé H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P. PLoS One. 2012;7(12):e50746.

  • The colorectal microRNAome. Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE. Proc Natl Acad Sci U S A. 2006 Mar 7;103(10):3687-92.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.