Mature miRNA: hsa-miR-615-3p

Mature miRNA

miRNA Name hsa-miR-615-3p
Previous Name hsa-miR-615
miRNA Sequence 5' - uccgagccugggucucccucuu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003283

Precursor miRNA

Precursor Name hsa-mir-615
Genomic Location chr12:54033950-54034045 (+); nearby genomic features
NCBI GENE ID 693200
miRBase ID MI0003628
Precursor Sequence 
cuc   ag   c          -uc     u        cu    g ug
   ggg  ggg gggagggggg   cccgg gcucggau  cgag g  c
   |||  ||| ||||||||||   ||||| ||||||||  |||| |   u
   ccc  ccc cccuucuccc   ggguc cgagccug  gcuu u  u
ccc   aa   -          ucu     -        --    g ua

References

  • Circ-PITX1 promotes non-small-cell lung cancer progression through regulating ETS1 expression via miR-615-5p. Guo Y, Pan J, Gao X, Zheng Y. Thorac Cancer. 2024 Sep;15(27):1946-1957.

  • miR615-3p inhibited FBLN1 and osteogenic differentiation of umbilical cord mesenchymal stem cells by associated with YTHDF2 in a m Yang H, Wang W, Liu H, Zhang C, Cao Y, Long L, Han X, Wang Y, Yan F, Li G, Zhu M, Jin L, Fan Z. Cell Prolif. 2024 Jun;57(6):e13607.

  • Pro-inflammatory Cytokines Promote the Occurrence and Development of Colitis-associated Colorectal Cancer by Inhibiting miR-615-5p. Sun D, Gong L, Wang X, Chen S, Yi J, Liu X. Inflamm Bowel Dis. 2023 Dec 5;29(12):1854-1864.

  • Circ_0067997 boosted the growth while repressed the apoptosis of SGC-7901/DDP cells via repressing miR-615-5p/AKT1 pathway. Jiao Y, Fu Y, Gong Y, Wang G, Chen S, Cai G, Wu S, Tang L. Cancer Biomark. 2023;37(1):27-38.

  • MiRNA-615-3p Alleviates Oxidative Stress Injury of Human Cardiomyocytes Via PI3K/Akt Signaling by Targeting MEF2A. Zhang D, Zhang G, Yu K, Zhang X, Jiang A. Anatol J Cardiol. 2022 May;26(5):373-381.

  • Circular RNA hsa_circ_0004396 acts as a sponge of miR-615-5p to promote non-small cell lung cancer progression and radioresistance through the upregulation of P21-Activated Kinase 1. Li D, Yan L, Zhang J, Gu F. J Clin Lab Anal. 2022 Jun;36(6):e24463.

  • The Influence of rs1859168 Polymorphism on Serum Expression of HOTTIP and Its Target miR-615-3p in Egyptian Patients with Breast Cancer. Abdelaleem OO, Shaker OG, AbdelHafez MN, Abdelghaffar NK, Eid HM, Zaidan M, Khalefa AA, Ahmed NA, Hemeda NF, Zaki OM, Awaji AAA, Mohammed SR. Biomolecules. 2021 May 14;11(5):733.

  • Hsa_circRNA_002144 promotes growth and metastasis of colorectal cancer through regulating miR-615-5p/LARP1/mTOR pathway. Wu M, Kong C, Cai M, Huang W, Chen Y, Wang B, Liu X. Carcinogenesis. 2021 Apr 30;42(4):601-610.

  • Clinical and Ilkhani K, Delgir S, Safi A, Seif F, Samei A, Bastami M, Alivand MR. Anticancer Agents Med Chem. 2021;21(7):927-935.

  • CircZNF609 is involved in the pathogenesis of focal segmental glomerulosclerosis by sponging miR-615-5p. Cui X, Fu J, Luan J, Qi H, Jiao C, Ran M, Wang D, Hao X, Zhang Y, Kopp JB, Pi J, Zhou H. Biochem Biophys Res Commun. 2020 Oct 20;531(3):341-349.

  • Long noncoding RNA HOTTIP promotes the metastatic potential of ovarian cancer through the regulation of the miR-615-3p/SMARCE1 pathway. Wu H, Wei HY, Chen QQ. Kaohsiung J Med Sci. 2020 Dec;36(12):973-982.

  • LncRNA HOTTIP promotes proliferation and inhibits apoptosis of gastric carcinoma cells via adsorbing miR-615-3p. Xiao ZS, Long H, Zhao L, Li HX, Zhang XN. Eur Rev Med Pharmacol Sci. 2020 Jun;24(12):6692-6698.

  • miR-615-3p promotes the epithelial-mesenchymal transition and metastasis of breast cancer by targeting PICK1/TGFBRI axis. Lei B, Wang D, Zhang M, Deng Y, Jiang H, Li Y. J Exp Clin Cancer Res. 2020 Apr 26;39(1):71.

  • Elevated miR-615-3p Expression Predicts Adverse Clinical Outcome and Promotes Proliferation and Migration of Prostate Cancer Cells. Laursen EB, Fredsøe J, Schmidt L, Strand SH, Kristensen H, Rasmussen AKI, Daugaard TF, Mouritzen P, Høyer S, Kristensen G, Stroomberg HV, Brasso K, Røder MA, Borre M, Sørensen KD. Am J Pathol. 2019 Dec;189(12):2377-2388.

  • Long non-coding RNA HOTTIP promotes hypoxia-induced glycolysis through targeting miR-615-3p/HMGB3 axis in non-small cell lung cancer cells. Shi J, Wang H, Feng W, Huang S, An J, Qiu Y, Wu K. Eur J Pharmacol. 2019 Nov 5;862:172615.

  • MicroRNA-615-5p Regulates Angiogenesis and Tissue Repair by Targeting AKT/eNOS (Protein Kinase B/Endothelial Nitric Oxide Synthase) Signaling in Endothelial Cells. Icli B, Wu W, Ozdemir D, Li H, Cheng HS, Haemmig S, Liu X, Giatsidis G, Avci SN, Lee N, Guimaraes RB, Manica A, Marchini JF, Rynning SE, Risnes I, Hollan I, Croce K, Yang X, Orgill DP, Feinberg MW. Arterioscler Thromb Vasc Biol. 2019 Jul;39(7):1458-1474.

  • Circular RNA 100146 functions as an oncogene through direct binding to miR-361-3p and miR-615-5p in non-small cell lung cancer. Chen L, Nan A, Zhang N, Jia Y, Li X, Ling Y, Dai J, Zhang S, Yang Q, Yi Y, Jiang Y. Mol Cancer. 2019 Jan 21;18(1):13.

  • lncRNA Gm15290 promotes cell proliferation and invasion in lung cancer through directly interacting with and suppressing the tumor suppressor Dong Y, Huo X, Sun R, Liu Z, Huang M, Yang S. Biosci Rep. 2018 Oct 31;38(5):BSR20181150.

  • LINC00657 played oncogenic roles in esophageal squamous cell carcinoma by targeting miR-615-3p and JunB. Sun Y, Wang J, Pan S, Yang T, Sun X, Wang Y, Shi X, Zhao X, Guo J, Zhang X. Biomed Pharmacother. 2018 Dec;108:316-324.

  • Long non-coding RNA HOTTIP promotes renal cell carcinoma progression through the regulation of the miR-615/IGF-2 pathway. Wang Q, Wu G, Zhang Z, Tang Q, Zheng W, Chen X, Chen F, Li Q, Che X. Int J Oncol. 2018 Nov;53(5):2278-2288.

    • There are 40 references associated with hsa-miR-615-3p. Click here to see the complete list in PubMed.