Mature miRNA: hsa-miR-570-3p

Mature miRNA

miRNA Name hsa-miR-570-3p
Previous Name hsa-miR-570
miRNA Sequence 5' - cgaaaacagcaauuaccuuugc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003235

Precursor miRNA

Precursor Name hsa-mir-570
Genomic Location chr3:195699401-195699497 (+); nearby genomic features
NCBI GENE ID 693155
MIM ID 614538
miRBase ID MI0003577
Precursor Sequence 
cuagauaag         g                 a      c c    
         uuauuaggu ggugcaaagguaauugc guuuuu c auuau
         ||||||||| ||||||||||||||||| |||||| | |||| u
         gguagucca ccacguuuccauuaacg caaaag g uaauu
------uga         a                 a      c u

References

  • Mechanism of circRNA_SMG6 mediating lung macrophage ECM degradation via miR-570-3p in microplastics-induced emphysema. Sun X, Xiao T, Qin J, Song Y, Lu K, Ding R, Shi W, Bian Q. Environ Int. 2024 May;187:108701.

  • Circ_ATAD3B inhibits cell proliferation of breast cancer via mediating the miR-570-3p/MX2 axis. Song B, Xu C, Zhang Y, Shan Y. Prev Med. 2023 Aug;173:107568.

  • MicroRNA-570 targets the HSP chaperone network, increases proteotoxic stress and inhibits mammary tumor cell migration. Okusha Y, Guerrero-Gimenez ME, Lang BJ, Borges TJ, Stevenson MA, Truman AW, Calderwood SK. Sci Rep. 2022 Sep 16;12(1):15582.

  • Construction and Analysis of lncRNA-Associated ceRNA Network in Atherosclerotic Plaque Formation. Li D, Ma Y, Deng W, Feng J. Biomed Res Int. 2022 Apr 15;2022:4895611.

  • Positive correlation between miR-570 and prognosis of colon cancer: inhibition of cell proliferation and invasion. Jiang G, Zhang R, Yang X, Zhang W, Hou Y. Clin Exp Med. 2022 May;22(2):193-200.

  • MicroRNA-570 is a novel regulator of cellular senescence and inflammaging. Baker JR, Vuppusetty C, Colley T, Hassibi S, Fenwick PS, Donnelly LE, Ito K, Barnes PJ. FASEB J. 2019 Feb;33(2):1605-1616.

  • miR-570 Inhibits Proliferation, Angiogenesis, and Immune Escape of Hepatocellular Carcinoma. Lin Y, Liu S, Su L, Su Q, Lin J, Huang X, Wang C. Cancer Biother Radiopharm. 2018 Aug;33(6):252-257.

  • Genome-wide CRISPR screen identifies HNRNPL as a prostate cancer dependency regulating RNA splicing. Fei T, Chen Y, Xiao T, Li W, Cato L, Zhang P, Cotter MB, Bowden M, Lis RT, Zhao SG, Wu Q, Feng FY, Loda M, He HH, Liu XS, Brown M. Proc Natl Acad Sci U S A. 2017 Jun 27;114(26):E5207-E5215.

  • miR-570 interacts with mitochondrial ATPase subunit g (ATP5L) encoding mRNA in stored platelets. Dahiya N, Sarachana T, Kulkarni S, Wood WH III, Zhang Y, Becker KG, Wang BD, Atreya CD. Platelets. 2017 Jan;28(1):74-81.

  • Evaluation of miR-27a, miR-181a, and miR-570 genetic variants with gallbladder cancer susceptibility and treatment outcome in a North Indian population. Gupta A, Sharma A, Yadav A, Rastogi N, Agrawal S, Kumar A, Kumar V, Misra S, Mittal B. Mol Diagn Ther. 2015 Oct;19(5):317-27.

  • Single-Nucleotide Polymorphisms in Cytochrome P450 2E1 (CYP2E1) 3'-Untranslated Region Affect the Regulation of CYP2E1 by miR-570. Nakano M, Mohri T, Fukami T, Takamiya M, Aoki Y, McLeod HL, Nakajima M. Drug Metab Dispos. 2015 Oct;43(10):1450-7.

  • MiR-570 inhibited the cell proliferation and invasion through directly targeting B7-H1 in hepatocellular carcinoma. Guo W, Tan W, Liu S, Huang X, Lin J, Liang R, Su L, Su Q, Wang C. Tumour Biol. 2015 Nov;36(11):9049-57.

  • MicroRNA-570 promotes lung carcinoma proliferation through targeting tumor suppressor KLF9. Tong XD, Liu TQ, Wang GB, Zhang CL, Liu HX. Int J Clin Exp Pathol. 2015 Mar 1;8(3):2829-34. eCollection 2015.

  • A miR-570 binding site polymorphism in the B7-H1 gene is associated with the risk of gastric adenocarcinoma. Wang W, Li F, Mao Y, Zhou H, Sun J, Li R, Liu C, Chen W, Hua D, Zhang X. Hum Genet. 2013 Jun;132(6):641-8.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • The colorectal microRNAome. Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE. Proc Natl Acad Sci U S A. 2006 Mar 7;103(10):3687-92.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.