Mature miRNA: hsa-miR-513c-3p

Mature miRNA

miRNA Name hsa-miR-513c-3p
miRNA Sequence 5' - uaaauuucaccuuucugagaaga - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0022728
Similar miRNAs hsa-miR-3606-3p, hsa-miR-513a-3p (sharing the same seed sequence with hsa-miR-513c-3p).

Precursor miRNA

Precursor Name hsa-mir-513c
Genomic Location chrX:147189704-147189787 (-); nearby genomic features
Clustered miRNAs hsa-mir-513c,hsa-mir-513b (within 10kb in genome)
NCBI GENE ID 100302114
miRBase ID MI0006649
Precursor Sequence 
-  -     g   c       ag      uc        gaa
 gc guaca ugc uuucuca  gaggug  guuuaugu   c
 || ||||| ||| |||||||  ||||||  ||||||||   
 cg caugu aug gaagagu  uuccac  uaaauaua   u
a  a     a   a       cu      uu        aaa

References

  • lncRNA SEMA3B-AS1 Inhibits miR-513c-5p to Regulate the Progression of Triple-negative Breast Cancer. Yu H, Wu Y, Huang J, Li S. Anticancer Res. 2023 Dec;43(12):5475-5484.

  • hsa-miR-424-5p and hsa-miR-513c-3p dysregulation mediated by IFN-γ is associated with salivary gland dysfunction in Sjögren's syndrome patients. Carvajal P, Aguilera S, Jara D, Indo S, Barrera MJ, González S, Molina C, Heathcote B, Hermoso M, Castro I, González MJ. J Autoimmun. 2023 Jul;138:103037.

  • MicroRNA-513c-5p is involved in the pathogenesis of preeclampsia by regulating of low-density lipoprotein receptor-associated protein 6. Zhou Q, Li H, Zhang Y, Peng W, Hou H, Gu M, Zhang F, Wang X, Gu X, Li L. BMC Pregnancy Childbirth. 2021 Dec 20;21(1):837.

  • LncRNA LOC728196/miR-513c axis facilitates glioma carcinogenesis by targeting TCF7. Wang O, Huang Y, Wu H, Zheng B, Lin J, Jin P. Gene. 2018 Dec 30;679:119-125.

  • LncRNA FLVCR1-AS1 acts as miR-513c sponge to modulate cancer cell proliferation, migration, and invasion in hepatocellular carcinoma. Zhang K, Zhao Z, Yu J, Chen W, Xu Q, Chen L. J Cell Biochem. 2018 Jul;119(7):6045-6056.

  • MiR-513c suppresses neuroblastoma cell migration, invasion, and proliferation through direct targeting glutaminase (GLS). Xia HL, Lv Y, Xu CW, Fu MC, Zhang T, Yan XM, Dai S, Xiong QW, Zhou Y, Wang J, Cao X. Cancer Biomark. 2017 Dec 6;20(4):589-596.

  • microRNA-513c suppresses the proliferation of human glioblastoma cells by repressing low-density lipoprotein receptor-related protein 6. Xu J, Sun T, Hu X. Mol Med Rep. 2015 Sep;12(3):4403-4409.

  • Rapid evolution of an X-linked microRNA cluster in primates. Zhang R, Peng Y, Wang W, Su B. Genome Res. 2007 May;17(5):612-7.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.