Mature miRNA: hsa-miR-509-5p

Mature miRNA

miRNA Name hsa-miR-509-5p
miRNA Sequence 5' - uacugcagacaguggcaauca - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004779
Similar miRNAs hsa-miR-4418, hsa-miR-509-3-5p (sharing the same seed sequence with hsa-miR-509-5p).

Precursor miRNA

Precursor Name hsa-mir-509-1
Genomic Location chrX:147260532-147260625 (-); nearby genomic features
Clustered miRNAs hsa-mir-509-2,hsa-mir-509-3,hsa-mir-509-1 (within 10kb in genome)
NCBI GENE ID 574514
MIM ID 300875
miRBase ID MI0003196
Precursor Sequence 
    c   -   ug    c   - ug     a   g       --g  u
caug ugu gug  guac cua c  cagac gug caaucau   ua a
|||| ||| |||  |||| ||| |  ||||| ||| |||||||   || 
guac aca uac  caug gau g  gucug cau guuagua   au a
    -   g   gu    a   g gu     -   g       aaa  u
Precursor Name hsa-mir-509-2
Genomic Location chrX:147258760-147258850 (-); nearby genomic features
Clustered miRNAs hsa-mir-514b,hsa-mir-509-2,hsa-mir-509-3,hsa-mir-509-1 (within 10kb in genome)
NCBI GENE ID 100126301
miRBase ID MI0005530
Precursor Sequence 
caugc   -   ug    c   - ug     a   g       --g  u
     ugu gug  guac cua c  cagac gug caaucau   ua a
     ||| |||  |||| ||| |  ||||| ||| |||||||   || 
     aca uac  caug gau g  gucug cau guuagua   au a
----c   g   gu    a   g gu     -   g       aaa  u

References

  • miR-509-5p promotes colorectal cancer cell ferroptosis by targeting SLC7A11. Elrebehy MA, Abdelghany TM, Elshafey MM, Gomaa MH, Doghish AS. Pathol Res Pract. 2023 Jul;247:154557.

  • Expression of miR-187 and miR-509-3p in serum of primary hepatocellular carcinoma patients and its evaluation of prognosis. Dai G, Shen S, Liu Y, Ma X, Fang Y, Weng Y, Li C. J BUON. 2021 Jul-Aug;26(4):1340-1345.

  • MiR-509-3-5p inhibits colon cancer malignancy by suppressing GTSE1. Li K. Biochem Biophys Res Commun. 2021 Sep 17;570:175-183.

  • A 4-microRNA signature for survival prognosis in pediatric and adolescent acute myeloid leukemia. Zhu R, Lin W, Zhao W, Fan F, Tang L, Hu Y. J Cell Biochem. 2019 Mar;120(3):3958-3968.

  • miR-509-3p promotes cisplatin-induced apoptosis in ovarian cancer cells through the regulation of anti-apoptotic genes. Chen W, Du J, Li X, Su J, Huang Y, Ding N, Zhang M, Jiang S. Pharmacogenomics. 2017 Dec;18(18):1671-1682.

  • MicroRNA-509-5p functions as an anti-oncogene in breast cancer via targeting SOD2. Song YH, Wang J, Nie G, Chen YJ, Li X, Jiang X, Cao WH. Eur Rev Med Pharmacol Sci. 2017 Aug;21(16):3617-3625.

  • miR-509-5p and miR-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer. Hiramoto H, Muramatsu T, Ichikawa D, Tanimoto K, Yasukawa S, Otsuji E, Inazawa J. Sci Rep. 2017 Jun 21;7(1):4002.

  • Inhibition of invasion and migration of prostate cancer cells by miRNA-509-5p via targeting MDM2. Tian XM, Luo YZ, He P, Li J, Ma ZW, An Y. Genet Mol Res. 2017 Feb 23;16(1).

  • MicroRNAs regulating meis1 expression and inducing cardiomyocyte proliferation. Pandey R, Yang Y, Jackson L, Ahmed RP. Cardiovasc Regen Med. 2016;3:e1468.

  • MiR-509-5p suppresses the proliferation, migration, and invasion of non-small cell lung cancer by targeting YWHAG. Wang P, Deng Y, Fu X. Biochem Biophys Res Commun. 2017 Jan 22;482(4):935-941.

  • Overexpression of miR-509 Increases Apoptosis and Inhibits Invasion via Suppression of Tumor Necrosis Factor-α in Triple-Negative Breast Cancer Hs578T Cells. Zhang G, Liu Z, Han Y, Wang X, Yang Z. Oncol Res. 2016;24(4):233-8.

  • The Tumor Suppressive Role of MiRNA-509-5p by Targeting FOXM1 in Non-Small Cell Lung Cancer. Ma N, Zhang W, Qiao C, Luo H, Zhang X, Liu D, Zang S, Zhang L, Bai J. Cell Physiol Biochem. 2016;38(4):1435-46.

  • miR-509 suppresses brain metastasis of breast cancer cells by modulating RhoC and TNF-α. Xing F, Sharma S, Liu Y, Mo YY, Wu K, Zhang YY, Pochampally R, Martinez LA, Lo HW, Watabe K. Oncogene. 2015 Sep 10;34(37):4890-900.

  • Mir-509-5p joins the Mdm2/p53 feedback loop and regulates cancer cell growth. Ren ZJ, Nong XY, Lv YR, Sun HH, An PP, Wang F, Li X, Liu M, Tang H. Cell Death Dis. 2014 Aug 21;5(8):e1387.

  • Tumor suppressive miR-509-5p contributes to cell migration, proliferation and antiapoptosis in renal cell carcinoma. Zhang WB, Pan ZQ, Yang QS, Zheng XM. Ir J Med Sci. 2013 Dec;182(4):621-7.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • Analysis of gene expression in normal and neoplastic human testis: new roles of RNA. Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E, Leffers H. Int J Androl. 2007 Aug;30(4):316-26; discussion 326-7.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

  • Identification of hundreds of conserved and nonconserved human microRNAs. Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z. Nat Genet. 2005 Jul;37(7):766-70.