Mature miRNA: hsa-miR-501-3p

Mature miRNA

miRNA Name hsa-miR-501-3p
miRNA Sequence 5' - aaugcacccgggcaaggauucu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004774
Similar miRNAs hsa-miR-502-3p (sharing the same seed sequence with hsa-miR-501-3p).

Precursor miRNA

Precursor Name hsa-mir-501
Genomic Location chrX:50009722-50009805 (+); nearby genomic features
Clustered miRNAs hsa-mir-532,hsa-mir-188,hsa-mir-500a,hsa-mir-362,hsa-mir-501,hsa-mir-500b,hsa-mir-660,hsa-mir-502 (within 10kb in genome)
NCBI GENE ID 574503
miRBase ID MI0003185
Precursor Sequence 
    u       -u       u u   u     agag   uuu
gcuc uccucuc  aauccuu g ccc gggug    ugc   c
|||| |||||||  ||||||| | ||| |||||    |||    u
cgag gggagag  uuaggaa c ggg cccac    acg   g
    u       uc       - -   -     -gua   uaa

References

  • MicroRNA, miR-501 regulate the V(D)J recombination in B cells. Kumari R, Roy U, Desai S, Mondal AS, Nair RR, Nilavar N, Choudhary B, Raghavan SC. Biochem J. 2023 Dec 20;480(24):2061-2077.

  • microRNA-501 controls myogenin Fahrner A, Luca E, Krützfeldt J. Mol Metab. 2023 May;71:101704.

  • MicroRNA-501-3p targeting TM4SF1 facilitates tumor-related behaviors of gastric cancer cells via EMT signaling pathway. Wei Y, Yin L, Xie X, Wu Z, Zhang J, Gao Y, Tang J. Mutat Res. 2022 Jul-Dec;825:111802.

  • Expression Profiles of Exosomal MicroRNAs Derived from Cerebrospinal Fluid in Patients with Congenital Hydrocephalus Determined by MicroRNA Sequencing. Chen S, Li H, Zheng J, Hao L, Jing T, Wu P, Zhang B, Ma D, Zhang J, Ma J. Dis Markers. 2022 Mar 4;2022:5344508.

  • MiR-501-5p alleviates cardiac dysfunction in septic patients through targeting NR4A3 to prevent its binding with Bcl-2. Gao L, Zhai Z, Shi Q, Yan J, Zhou L, Wu Y, Zeng Q, Tian G, Li H. Cell Cycle. 2022 May;21(9):961-971.

  • Importance of miR-141-5p and miR-501-5P expression in patients with HBV infection. Lak R, Yaghobi R, Garshasbi M. Cell Mol Biol (Noisy-le-grand). 2021 Nov 25;67(3):184-189.

  • Exercise as a model to identify microRNAs linked to human cognition: a role for microRNA-409 and microRNA-501. Goldberg M, Islam MR, Kerimoglu C, Lancelin C, Gisa V, Burkhardt S, Krüger DM, Marquardt T, Malchow B, Schmitt A, Falkai P, Sananbenesi F, Fischer A. Transl Psychiatry. 2021 Oct 8;11(1):514.

  • MiR-501 promotes tumor proliferation and metastasis by targeting HOXD10 in endometrial cancer. Sun X, Hou L, Qiu C, Kong B. Cell Mol Biol Lett. 2021 May 22;26(1):20.

  • Osteosarcoma-derived exosomal miR-501-3p promotes osteoclastogenesis and aggravates bone loss. Lin L, Wang H, Guo W, He E, Huang K, Zhao Q. Cell Signal. 2021 Jun;82:109935.

  • MiR-501-3p promotes osteosarcoma cell proliferation, migration and invasion by targeting BCL7A. Dai J, Lu L, Kang L, Zhang J. Hum Cell. 2021 Mar;34(2):624-633.

  • LINC00452 promotes ovarian carcinogenesis through increasing ROCK1 by sponging miR-501-3p and suppressing ubiquitin-mediated degradation. Yang J, Wang WG, Zhang KQ. Aging (Albany NY). 2020 Nov 9;12(21):21129-21146.

  • MiR-501-3p functions as a tumor suppressor in non-small cell lung cancer by downregulating RAP1A. Lu J, Zhou L, Wu B, Duan Y, Sun Y, Gu L, Xu D, Du C. Exp Cell Res. 2020 Feb 1;387(1):111752.

  • microRNA-501-5p promotes cell proliferation and migration in gastric cancer by downregulating LPAR1. Ma X, Feng J, Lu M, Tang W, Han J, Luo X, Zhao Q, Yang L. J Cell Biochem. 2020 Feb;121(2):1911-1922.

  • miR‑501‑3p promotes colorectal cancer progression via activation of Wnt/β‑catenin signaling. Wu F, Xing T, Gao X, Liu F. Int J Oncol. 2019 Sep;55(3):671-683.

  • Inhibition of KHSRP sensitizes colorectal cancer to 5-fluoruracil through miR-501-5p-mediated ERRFI1 mRNA degradation. Pan R, Cai W, Sun J, Yu C, Li P, Zheng M. J Cell Physiol. 2020 Feb;235(2):1576-1587.

  • Macrophage-derived exosomal microRNA-501-3p promotes progression of pancreatic ductal adenocarcinoma through the TGFBR3-mediated TGF-β signaling pathway. Yin Z, Ma T, Huang B, Lin L, Zhou Y, Yan J, Zou Y, Chen S. J Exp Clin Cancer Res. 2019 Jul 15;38(1):310.

  • Exosomal transfer of miR-501 confers doxorubicin resistance and tumorigenesis via targeting of BLID in gastric cancer. Liu X, Lu Y, Xu Y, Hou S, Huang J, Wang B, Zhao J, Xia S, Fan S, Yu X, Du Y, Hou L, Li Z, Ding Z, An S, Huang B, Li L, Tang J, Ju J, Guan H, Song B. Cancer Lett. 2019 Sep 10;459:122-134.

  • A four serum-miRNA panel serves as a potential diagnostic biomarker of osteosarcoma. Huang C, Wang Q, Ma S, Sun Y, Vadamootoo AS, Jin C. Int J Clin Oncol. 2019 Aug;24(8):976-982.

  • miR-501 acts as an independent prognostic factor that promotes the epithelial-mesenchymal transition through targeting JDP2 in hepatocellular carcinoma. Yu W, Deng W, Zhao Q, Zhuang H, Zhang C, Jian Z. Hum Cell. 2019 Jul;32(3):343-351.

  • MicroRNA-501-3p restricts prostate cancer growth through regulating cell cycle-related and expression-elevated protein in tumor/cyclin D1 signaling. Zhang Z, Shao L, Wang Y, Luo X. Biochem Biophys Res Commun. 2019 Feb 12;509(3):746-752.

    • There are 34 references associated with hsa-miR-501-3p. Click here to see the complete list in PubMed.