Mature miRNA: hsa-miR-492

Mature miRNA

miRNA Name hsa-miR-492
miRNA Sequence 5' - aggaccugcgggacaagauucuu - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
Expression Profile Display table
miRBase ID MIMAT0002812

Precursor miRNA

Precursor Name hsa-mir-492
Genomic Location chr12:94834398-94834513 (+); nearby genomic features
NCBI GENE ID 574449
MIM ID 614384
miRBase ID MI0003131
Precursor Sequence 
caa  a      cuacuacag  c   c ag  c           gau        ccacc
   cu cagcca         ga cau g  ga cugcgggacaa   ucuuggug     a
   || ||||||         || ||| |  || |||||||||||   ||||||||      u
   ga gucggu         cu gua c  cu gacguccuguu   aggaccgc     u
gua  c      ------caa  c   a aa  a           ---        aagag

References

  • hsa_circ_0129047 Upregulates LYVE1 to Inhibit Hepatocellular Carcinoma Progression by Sponging miR-492. Feng Z, Wu J. Dis Markers. 2023 Sep 30;2023:6978234.

  • NamiRNA-enhancer network of miR-492 activates the NR2C1-TGF-β/Smad3 pathway to promote epithelial-mesenchymal transition of pancreatic cancer. Liu S, He X, Di Y, Li Q, Li F, Ma Y, Chen L, Gao Y, Xu J, Yang S, Xu L, Corpe C, Ling Y, Zhang X, Xu J, Yu W, Wang J. Carcinogenesis. 2023 May 26;44(2):153-165.

  • The immunogenic involvement of miRNA-492 in mycoplasma pneumoniae infection in pediatric patients. Jia Z, Sun Q, Zheng Y, Xu J, Wang Y. J Pediatr (Rio J). 2023 Mar-Apr;99(2):187-192.

  • Association of miRNA-492 rs2289030 G>C and miRNA-938 rs2505901 T>C Gene Polymorphisms with Biliary Atresia Susceptibility. Su L, Tian Y, Fu M, Zhang RZ, Ou XF, Xia HM, Li RZ. Biomed Environ Sci. 2021 Jul 20;34(7):577-580.

  • Association between Zheng Y, Liu Y, Wang M, He Q, Xie X, Lu L, Zhong W. J Int Med Res. 2020 Oct;48(10):300060520961680.

  • Effects of miR-492 on migration, invasion, EMT and prognosis in ovarian cancer by targeting SOX7. Wang Z, Liu Y, Wang M, Zhao J. J BUON. 2020 Mar-Apr;25(2):797-804.

  • Circular RNA circ_0001368 inhibited growth and invasion in renal cell carcinoma by sponging miR-492 and targeting LATS2. Chen L, Wu D, Ding T. Gene. 2020 Aug 30;753:144781.

  • miR-492 promotes chemoresistance to CDDP and metastasis by targeting inhibiting DNMT3B and induces stemness in gastric cancer. Wu S, Xie J, Shi H, Wang ZW. Biosci Rep. 2020 Mar 27;40(3):BSR20194342.

  • MiR-492 exerts tumor-promoting function in prostate cancer through repressing SOCS2 expression. Shi LP, Liang M, Li FF, Li T, Lai DH, Xie QL, Yin YF, Liu YF. Eur Rev Med Pharmacol Sci. 2019 Feb;23(3):992-1001.

  • Inhibition of microRNA‑492 attenuates cell proliferation and invasion in retinoblastoma via directly targeting LATS2. Sun Z, Zhang A, Zhang L. Mol Med Rep. 2019 Mar;19(3):1965-1971.

  • Diabetes, Hypertension, and Cardiovascular Disease: Clinical Insights and Vascular Mechanisms. Petrie JR, Guzik TJ, Touyz RM. Can J Cardiol. 2018 May;34(5):575-584.

  • MiR-492 regulates metastatic properties of hepatoblastoma via CD44. von Frowein J, Hauck SM, Kappler R, Pagel P, Fleischmann KK, Magg T, Cairo S, Roscher A, von Schweinitz D, Schmid I. Liver Int. 2018 Jul;38(7):1280-1291.

  • [The role of miR-492 in the regulation of OK blood group antigen expression on red blood cells]. Ye L, Wang C, Yang Q, Zhu Z. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2017 Oct 10;34(5):680-683.

  • MicroRNA-492 overexpression involves in cell proliferation, migration, and radiotherapy response of cervical squamous cell carcinomas. Liu M, An J, Huang M, Wang L, Tu B, Song Y, Ma K, Wang Y, Wang S, Zhu H, Xu N, Wu L. Mol Carcinog. 2018 Jan;57(1):32-43.

  • MicroRNA-492 overexpression exerts suppressive effects on the progression of osteosarcoma by targeting PAK7. Song X, Xie Y, Liu Y, Shao M, Yang W. Int J Mol Med. 2017 Sep;40(3):891-897.

  • miR-492G>C polymorphism (rs2289030) is associated with overall survival of hepatocellular carcinoma patients. Yu G, Xiao Q, Ma XP, Chen X, Shi Z, Zhang LY, Chen H, Zhang P, Ding DL, Huang HX, Saiyin H, Chen TY, Lu PX, Wang NJ, Yu H, Sun J, Conran C, Zheng SL, Xu J, Yu L, Jiang DK. Tumour Biol. 2016 Jul;37(7):8961-72.

  • MiR-492 is functionally involved in Oxaliplatin resistance in colon cancer cells LS174T via its regulating the expression of CD147. Peng L, Zhu H, Wang J, Sui H, Zhang H, Jin C, Li L, Xu T, Miao R. Mol Cell Biochem. 2015 Jul;405(1-2):73-9.

  • Upregulation of microRNA-492 induced by epigenetic drug treatment inhibits the malignant phenotype of clear cell renal cell carcinoma in vitro. Wu A, Wu K, Li M, Bao L, Shen X, Li S, Li J, Yang Z. Mol Med Rep. 2015 Jul;12(1):1413-20.

  • MiR-492 contributes to cell proliferation and cell cycle of human breast cancer cells by suppressing SOX7 expression. Shen F, Cai WS, Feng Z, Li JL, Chen JW, Cao J, Xu B. Tumour Biol. 2015 Mar;36(3):1913-21.

  • Myeloid zinc-finger 1 (MZF-1) suppresses prostate tumor growth through enforcing ferroportin-conducted iron egress. Chen Y, Zhang Z, Yang K, Du J, Xu Y, Liu S. Oncogene. 2015 Jul;34(29):3839-47.

    • There are 29 references associated with hsa-miR-492. Click here to see the complete list in PubMed.