Mature miRNA: hsa-miR-491-5p

Mature miRNA

miRNA Name hsa-miR-491-5p
Previous Name hsa-miR-491
miRNA Sequence 5' - aguggggaacccuuccaugagg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0002807

Precursor miRNA

Precursor Name hsa-mir-491
Genomic Location chr9:20716105-20716188 (+); nearby genomic features
NCBI GENE ID 574444
miRBase ID MI0003126
Precursor Sequence 
 ug       ug     u      cc   c          a
u  acuuagc  gguag ggggaa  cuu caugaggagu g
|  |||||||  ||||| ||||||  ||| ||||||||||  a
g  ugggucg  ccauc ucccuu  gaa guauuccuca a
 gu       gu     u      -a   c          c

References

  • circCPA4 induces malignant behaviors of prostate cancer via miR-491-5p/SHOC2 feedback loop. Xu W, Zhong Z, Gu L, Xiao Y, Chen B, Hu W. Clinics (Sao Paulo). 2024 Jan 13;79:100314.

  • miR-491-5p regulates the susceptibility of glioblastoma to ferroptosis through TP53. Jie XF, Li YP, Liu S, Fu Y, Xiong YY. Biochem Biophys Res Commun. 2023 Sep 3;671:309-317.

  • Inhibition of ox-LDL-induced endothelial cell injury by LINC02381 knockdown through the microRNA-491-5p/transcription factor 7 axis. Zhu X, Xu H, Chen B. Immun Inflamm Dis. 2023 Mar;11(3):e785.

  • The Tumor Suppressor Roles and Mechanisms of MiR-491 in Human Cancers. Sadri F, Hosseini SF, Aghayei A, Fereidouni M, Rezaei Z. DNA Cell Biol. 2022 Sep;41(9):810-823.

  • miR‑491‑3p functions as a tumor suppressor in non‑small cell lung cancer by targeting fibroblast growth factor 5. Zhang G, Zheng H, Wang L. Oncol Rep. 2022 Sep;48(3):164.

  • lncRNA H19 promotes glioblastoma multiforme development by activating autophagy by sponging miR-491-5p. Wang G, Lin X, Han H, Zhang H, Li X, Feng M, Jiang C. Bioengineered. 2022 May;13(5):11440-11455.

  • Reduced Circulating Levels of miR-491-5p and miR-485-3p Are Associated with the Occurrence of Vertebral Fractures in Postmenopausal Women with Osteoporosis. Xu J, Li M, Pei W, Ding J, Pan Y, Peng H, Lin S, Huang Y. Genet Res (Camb). 2022 Mar 7;2022:3838126.

  • Circular RNA CELF1 drives immunosuppression and anti-PD1 therapy resistance in non-small cell lung cancer via the miR-491-5p/EGFR axis. Ge W, Chi H, Tang H, Xu J, Wang J, Cai W, Ma H. Aging (Albany NY). 2021 Nov 17;13(22):24560-24579.

  • Circ_0009910 sponges miR-491-5p to promote acute myeloid leukemia progression through modulating B4GALT5 expression and PI3K/AKT signaling pathway. Wu Y, Zhao B, Chen X, Geng X, Zhang Z. Int J Lab Hematol. 2022 Apr;44(2):320-332.

  • Identification of the Novel Tumor Suppressor Role of FOCAD/miR-491-5p to Inhibit Cancer Stemness, Drug Resistance and Metastasis via Regulating RABIF/MMP Signaling in Triple Negative Breast Cancer. Huang WC, Chi HC, Tung SL, Chen PM, Shih YC, Huang YC, Chu PY. Cells. 2021 Sep 24;10(10):2524.

  • A functional polymorphism at the miR‑491‑5p binding site in the 3'‑untranslated region of the MMP‑9 gene increases the risk of developing ventilator‑associated pneumonia. Meng W, Cao X, Sun W, Zheng L, Fan B, Zhou S, Liu H, Wang H, Wang W, Liu X. Int J Mol Med. 2021 Dec;48(6):217.

  • microRNA-491-5p regulates osteogenic differentiation of bone marrow stem cells in type 2 diabetes. Wang L, Liang C, Lin X, Liu C, Li J. Oral Dis. 2023 Jan;29(1):308-321.

  • Plasma extracellular vesicle microRNA-491-5p as diagnostic and prognostic marker for head and neck squamous cell carcinoma. Panvongsa W, Siripoon T, Worakitchanon W, Arsa L, Trachu N, Jinawath N, Ngamphaiboon N, Chairoungdua A. Cancer Sci. 2021 Oct;112(10):4257-4269.

  • LncRNA MALAT1 Regulating Lung Carcinoma Progression via the miR-491-5p/UBE2C Axis. Dai J, Zhou N, Wu R, Du J, Miao S, Gong K, Yang L, Chen W, Li X, Li C, Wu Y. Pathol Oncol Res. 2021 Mar 29;27:610159.

  • Circ_0006988 promotes the proliferation, metastasis and angiogenesis of non-small cell lung cancer cells by modulating miR-491-5p/MAP3K3 axis. Yang C, Shi J, Wang J, Hao D, An J, Jiang J. Cell Cycle. 2021 Jul;20(13):1334-1346.

  • Tumor Suppressive Role of miR-342-5p in Human Chondrosarcoma Cells and 3D Organoids. Veys C, Benmoussa A, Contentin R, Duchemin A, Brotin E, Lafont JE, Saintigny Y, Poulain L, Denoyelle C, Demoor M, Legendre F, Galéra P. Int J Mol Sci. 2021 May 25;22(11):5590.

  • LINC00460 promotes pancreatic cancer progression by sponging miR-491-5p. Wu J, Sun S, Liao W, Chen E, Wang X, Song Y, Duan F, Deng W, Li S. J Gene Med. 2021 Jun;23(6):e3333.

  • circ‑0000212 promotes cell proliferation of colorectal cancer by sponging miR‑491 and modulating FOXP4 expression. Wu H, Tao Y, Zhang W, Wang G, Zhang Q. Mol Med Rep. 2021 Apr;23(4):300.

  • NOTCH3, a crucial target of miR-491-5p/miR-875-5p, promotes gastric carcinogenesis by upregulating PHLDB2 expression and activating Akt pathway. Kang W, Zhang J, Huang T, Zhou Y, Wong CC, Chan RCK, Dong Y, Wu F, Zhang B, Wu WKK, Chan MWY, Cheng ASL, Yu J, Wong N, Lo KW, To KF. Oncogene. 2021 Mar;40(9):1578-1594.

  • MicroRNA‑491‑5p inhibits trophoblast cell migration and invasion through targeting matrix metalloproteinase‑9 in preeclampsia. Liu E, Zhou Y, Li J, Zhang D. Mol Med Rep. 2020 Dec;22(6):5033-5040.

    • There are 65 references associated with hsa-miR-491-5p. Click here to see the complete list in PubMed.