Mature miRNA: hsa-miR-4784

Mature miRNA

miRNA Name hsa-miR-4784
miRNA Sequence 5' - ugaggagaugcugggacuga - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019948
Similar miRNAs hsa-miR-3150b-3p (sharing the same seed sequence with hsa-miR-4784).

Precursor miRNA

Precursor Name hsa-mir-4784
Genomic Location chr2:131491160-131491236 (-); nearby genomic features
NCBI GENE ID 100616378
miRBase ID MI0017429
Precursor Sequence 
u   -  g cu     gau  u     u   a  gu a
 gac ug g  gagga   gc gggac gag gu  c u
 ||| || |  |||||   || ||||| ||| ||  |  g
 uug ac c  cuccu   cg cccug cuc cg  g g
g   u  g cu     acu  u     c   -  ag u

References

  • ELK1 activated-long noncoding RNA LBX2-AS1 aggravates the progression of ovarian cancer through targeting miR-4784/KDM5C axis. Gu H, Lin R, Zheng F, Zhang Q. J Mol Histol. 2021 Feb;52(1):31-44.

  • LINC01133 promotes the progression of cervical cancer by sponging miR-4784 to up-regulate AHDC1. Feng Y, Qu L, Wang X, Liu C. Cancer Biol Ther. 2019;20(12):1453-1461.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.