Mature miRNA: hsa-miR-3942-5p

Mature miRNA

miRNA Name hsa-miR-3942-5p
Previous Name hsa-miR-3942
miRNA Sequence 5' - aagcaauacuguuaccugaaau - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0018358
Similar miRNAs hsa-miR-4703-5p (sharing the same seed sequence with hsa-miR-3942-5p).

Precursor miRNA

Precursor Name hsa-mir-3942
Genomic Location chr15:35372256-35372364 (-); nearby genomic features
NCBI GENE ID 100500904
miRBase ID MI0016599
Precursor Sequence 
ucu     ----       c       a c          c       ag    cga
   ucagu    augacac ucaaaga g aauacuguua cugaaau  gcug   a
   |||||    ||||||| ||||||| | |||||||||| |||||||  ||||    g
   aguca    uacugug aguuucu c uuaugacaau gacuuua  ugac   a
--c     cuua       a       a a          a       --    aau

References

  • Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia. Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML. Leukemia. 2011 Sep;25(9):1389-99.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers. Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH. PLoS One. 2010 May 14;5(5):e10563.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.