Mature miRNA: hsa-miR-3928-3p

Mature miRNA

miRNA Name hsa-miR-3928-3p
miRNA Sequence 5' - ggaggaaccuuggagcuucggc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0018205

Precursor miRNA

Precursor Name hsa-mir-3928
Genomic Location chr22:31160062-31160119 (-); nearby genomic features
NCBI GENE ID 100500901
miRBase ID MI0016438
Precursor Sequence 
                   gc    ggg
gcugaagcucuaagguucc  cugc   c
|||||||||||||||||||  ||||    a
cggcuucgagguuccaagg  ggcg   g
                   -a    aag

References

  • MicroRNA 3928 Suppresses Glioblastoma through Downregulation of Several Oncogenes and Upregulation of p53. Mulcahy EQX, Zhang Y, ColÏŒn RR, Cain SR, Gibert MK Jr, Dube CJ, Hafner M, Abounader R. Int J Mol Sci. 2022 Apr 1;23(7):3930.

  • Salivary microRNA miR-let-7a-5p and miR-3928 could be used as potential diagnostic bio-markers for head and neck squamous cell carcinoma. Fadhil RS, Wei MQ, Nikolarakos D, Good D, Nair RG. PLoS One. 2020 Mar 24;15(3):e0221779.

  • MicroRNA induction by copy number gain is associated with poor outcome in squamous cell carcinoma of the lung. Xia E, Kanematsu S, Suenaga Y, Elzawahry A, Kondo H, Otsuka N, Moriya Y, Iizasa T, Kato M, Yoshino I, Yokoi S. Sci Rep. 2018 Oct 18;8(1):15363.

  • Birth and expression evolution of mammalian microRNA genes. Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H. Genome Res. 2013 Jan;23(1):34-45.

  • miR-3928 activates ATR pathway by targeting Dicer. Chang L, Hu W, Ye C, Yao B, Song L, Wu X, Ding N, Wang J, Zhou G. RNA Biol. 2012 Oct;9(10):1247-54.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Discovery of novel microRNAs in female reproductive tract using next generation sequencing. Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH. PLoS One. 2010 Mar 10;5(3):e9637.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.