Mature miRNA: hsa-miR-3691-5p

Mature miRNA

miRNA Name hsa-miR-3691-5p
Previous Name hsa-miR-3691
miRNA Sequence 5' - aguggaugauggagacucgguac - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0018120

Precursor miRNA

Precursor Name hsa-mir-3691
Genomic Location chr6:5148233-5148322 (-); nearby genomic features
NCBI GENE ID 100500900
miRBase ID MI0016092
Precursor Sequence 
u            u  u        g     c   a      gc
 ugaggcacuggg ag ggaugaug agacu ggu cccacu  u
 |||||||||||| || |||||||| ||||| ||| ||||||  
 acuccgugacuc uc ccuacugc ucuga cca gggugg  g
a            c  u        g     a   g      ga

References

  • MiR-3691-5p is upregulated in docosahexaenoic acid-treated vascular endothelial cell and targets serpin family E member 1. Wu Y, Chen Z, Wang Y, Peng F. J Cell Biochem. 2020 Mar;121(3):2363-2371.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood. Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A. BMC Genomics. 2010 May 7;11:288.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.