Mature miRNA: hsa-miR-346

Mature miRNA

miRNA Name hsa-miR-346
miRNA Sequence 5' - ugucugcccgcaugccugccucu - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
Targeted Pathways miRDB
Expression Profile Display table
miRBase ID MIMAT0000773

Precursor miRNA

Precursor Name hsa-mir-346
Genomic Location chr10:86264694-86264788 (-); nearby genomic features
NCBI GENE ID 442911
MIM ID 611190
miRBase ID MI0000826
Precursor Sequence 
-g u      g ug    u    cu    -  aug        u  guug
  g cucugu u  ggcg cugu  gccc gc   ccugccuc cu    c
  | |||||| |  |||| ||||  |||| ||   |||||||| ||    
  c gagacg g  ccgu gacg  cggg cg   ggacggag ga    u
gg -      - gu    c    uc    u  --g        -  aguc

References

  • CircHIPK3 contributes to human villous trophoblast growth, migration and invasion via modulating the pathway of miR-346/KCMF1. Wang W, Liu J, Pan E. Placenta. 2022 Feb;118:46-54.

  • Tumor suppressor LHX6 upregulation contributes to the inhibitory effect of miR-346 knockdown on colorectal cancer cell growth. Li X, Zhou Y, Wen P, Yuan Y, Xiao Z, Shi H, Zhou H. Environ Toxicol. 2022 Mar;37(3):435-445.

  • Hsa_circ_0069244 acts as the sponge of miR-346 to inhibit non-small cell lung cancer progression by regulating XPC expression. Shi J, Wang H, Feng W, Huang S, An J, Wang L, Jiang J. Hum Cell. 2021 Sep;34(5):1490-1503.

  • Potential biomarker enhancing the activity of tuberculosis, hsa-miR-346. Uno S, Nishimura T, Nishio K, Kohsaka A, Tamizu E, Nakano Y, Kagyo J, Nakajima Y, Arai R, Hasegawa H, Arakawa K, Kashimura S, Ishii R, Miyazaki N, Uwamino Y, Hasegawa N. Tuberculosis (Edinb). 2021 Jul;129:102101.

  • Circ‑TOP2A acts as a ceRNA for miR‑346 and contributes to glioma progression via the modulation of sushi domain‑containing 2. Sang J, Li X, Lv L, Zhang C, Zhang X, Li G. Mol Med Rep. 2021 Apr;23(4):255.

  • The Potential Role of Selected miRNA in Uveal Melanoma Primary Tumors as Early Biomarkers of Disease Progression. Wróblewska JP, Lach MS, Ustaszewski A, Kulcenty K, Ibbs M, JagieÅ‚Å‚o I, Suchorska WM, MarszaÅ‚ek A. Genes (Basel). 2020 Mar 2;11(3):271.

  • Oncomir MicroRNA-346 Is Upregulated in Colons of Patients With Primary Sclerosing Cholangitis. Kempinska-Podhorodecka A, Blatkiewicz M, Wunsch E, Krupa L, Gutkowski K, Milkiewicz P, Milkiewicz M. Clin Transl Gastroenterol. 2020 Jan;11(1):e00112.

  • MiR-346-5p promotes colorectal cancer cell proliferation in vitro and in vivo by targeting FBXL2 and activating the β-catenin signaling pathway. Pan S, Wu W, Ren F, Li L, Li Y, Li W, Wang A, Liu D, Dong Y. Life Sci. 2020 Mar 1;244:117300.

  • Hsa-miR-346 plays a role in the development of sepsis by downregulating SMAD3 expression and is negatively regulated by lncRNA MALAT1. Yang Q, Cao K, Jin G, Zhang J. Mol Cell Probes. 2019 Oct;47:101444.

  • LncRNA NBAT1 suppresses cell proliferation and migration via miR-346/GSK-3β axis in renal carcinoma. Xue S, Wang S, Li J, Guan H, Jiang S, Guo Y, Li Q. IUBMB Life. 2019 Nov;71(11):1720-1728.

  • Novel upregulation of amyloid-β precursor protein (APP) by microRNA-346 via targeting of APP mRNA 5'-untranslated region: Implications in Alzheimer's disease. Long JM, Maloney B, Rogers JT, Lahiri DK. Mol Psychiatry. 2019 Mar;24(3):345-363.

  • LncRNA DGCR5 represses the development of hepatocellular carcinoma by targeting the miR-346/KLF14 axis. Wang YG, Liu J, Shi M, Chen FX. J Cell Physiol. 2018 Jan;234(1):572-580.

  • circFBLIM1 act as a ceRNA to promote hepatocellular cancer progression by sponging miR-346. Bai N, Peng E, Qiu X, Lyu N, Zhang Z, Tao Y, Li X, Wang Z. J Exp Clin Cancer Res. 2018 Jul 27;37(1):172.

  • miR-346 Promotes HCC Progression by Suppressing Breast Cancer Metastasis Suppressor 1 Expression. Guo Z, Li J, Sun J, Sun L, Zhou Y, Yu Z. Oncol Res. 2018 Aug 23;26(7):1073-1081.

  • miR-346 functions as a pro-survival factor under ER stress by activating mitophagy. Guo J, Yang Z, Yang X, Li T, Liu M, Tang H. Cancer Lett. 2018 Jan 28;413:69-81.

  • When figures and data contradict text: MiR346 is apparently reduced in breast cancer tissue, contrary to claims by a paper's author. Lahiri DK, Maloney B, Sambamurti K. Gene. 2017 Nov 30;635:46-47.

  • hsa-miR-346 is a potential serum biomarker of Mycobacterium avium complex pulmonary disease activity. Nishimura T, Tamizu E, Uno S, Uwamino Y, Fujiwara H, Nishio K, Nakano Y, Shiono H, Namkoong H, Hoshino Y, Iwata S, Hasegawa N. J Infect Chemother. 2017 Oct;23(10):703-708.

  • Differential miR-346 and miR-582-3p Expression in Association with Selected Maternal and Fetal Complications. Tsai PY, Li SH, Chen WN, Tsai HL, Su MT. Int J Mol Sci. 2017 Jul 19;18(7):1570.

  • MiR-346 and TRAb as Predicative Factors for Relapse in Graves' Disease Within One Year. Li J, Cai Y, Sun X, Yao D, Xia J. Horm Metab Res. 2017 Mar;49(3):180-184.

  • MiR-346 promotes the biological function of breast cancer cells by targeting SRCIN1 and reduces chemosensitivity to docetaxel. Yang F, Luo LJ, Zhang L, Wang DD, Yang SJ, Ding L, Li J, Chen D, Ma R, Wu JZ, Tang JH. Gene. 2017 Feb 5;600:21-28.

    • There are 38 references associated with hsa-miR-346. Click here to see the complete list in PubMed.