Mature miRNA: hsa-miR-33b-5p

Mature miRNA

miRNA Name hsa-miR-33b-5p
Previous Name hsa-miR-33b
miRNA Sequence 5' - gugcauugcuguugcauugc - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003301
Similar miRNAs hsa-miR-33a-5p (sharing the same seed sequence with hsa-miR-33b-5p).

Precursor miRNA

Precursor Name hsa-mir-33b
Genomic Location chr17:17813836-17813931 (-); nearby genomic features
Clustered miRNAs hsa-mir-6777,hsa-mir-33b (within 10kb in genome)
NCBI GENE ID 693120
MIM ID 613486
miRBase ID MI0003646
Precursor Sequence 
-----  ---    -   c   c  -          uu         g   g
     gc   gggc ggc ccg gg ugcauugcug  gcauugcac ugu u
     ||   |||| ||| ||| || ||||||||||  ||||||||| |||  g
     cg   cccg ccg ggc cc acgugacggc  cgugacgug gcg a
cacca  guc    g   a   -  g          uc         g   g

References

  • Circulating microRNA-33b levels are associated with the presence and severity of coronary heart disease. Chen C, Liu Q, Li Y, Yu JW, Wang SD, Xu JL, Liu L. Scand J Clin Lab Invest. 2024 Apr;84(2):133-137.

  • Role of CircCHD2 in the pathogenesis of gestational diabetes mellitus by regulating autophagy via miR-33b-3p/ULK1 axis. Bao Y, Wu L, Liu Y, Fan C, Zhang J, Yang J. Placenta. 2024 Jan;145:27-37.

  • Inhibition of microRNA-33b in humanized mice ameliorates nonalcoholic steatohepatitis. Miyagawa S, Horie T, Nishino T, Koyama S, Watanabe T, Baba O, Yamasaki T, Sowa N, Otani C, Matsushita K, Kojima H, Kimura M, Nakashima Y, Obika S, Kasahara Y, Kotera J, Oka K, Fujita R, Sasaki T, Takemiya A, Hasegawa K, Kimura T, Ono K. Life Sci Alliance. 2023 Jun 1;6(8):e202301902.

  • miR-33b in human cancer: Mechanistic and clinical perspectives. Zhang W, Jiang B, Zhu H, Cheng A, Li C, Huang H, Li X, Kuang Y. Biomed Pharmacother. 2023 May;161:114432.

  • Long non-coding RNA HIF1A-AS2 modulates the proliferation, migration, and phenotypic switch of aortic smooth muscle cells in aortic dissection via sponging microRNA-33b. Zhang K, Qi Y, Wang M, Chen Q. Bioengineered. 2022 Mar;13(3):6383-6395.

  • Microrna analysis of human decidua mesenchymal stromal cells from preeclampsia patients. Kamali Simsek N, Benian A, Sevgin K, Ergun Y, Goksever Celik H, Karahuseyinoglu S, Gunel T. Placenta. 2021 Nov;115:12-19.

  • Long Non-Coding RNA TP53TG1 Upregulates SHCBP1 to Promote Retinoblastoma Progression by Sponging miR-33b. Wang H, Zhang Z, Zhang Y, Liu S, Li L. Cell Transplant. 2021 Jan-Dec;30:9636897211025223.

  • LncRNA MSC-AS1 facilitates lung adenocarcinoma through sponging miR-33b-5p to up-regulate GPAM. Li S, Yang S, Qiu C, Sun D. Biochem Cell Biol. 2021 Apr;99(2):241-248.

  • MicroRNA-33 Inhibits Adaptive Thermogenesis and Adipose Tissue Beiging. Afonso MS, Verma N, van Solingen C, Cyr Y, Sharma M, Perie L, Corr EM, Schlegel M, Shanley LC, Peled D, Yoo JY, Schmidt AM, Mueller E, Moore KJ. Arterioscler Thromb Vasc Biol. 2021 Apr;41(4):1360-1373.

  • Downregulation of IRAK3 by miR-33b-3p relieves chondrocyte inflammation and apoptosis in an in vitro osteoarthritis model. Tao T, Zhang Y, Wei H, Heng K. Biosci Biotechnol Biochem. 2021 Feb 24;85(3):545-552.

  • CircRNA_0050463 promotes influenza A virus replication by sponging miR-33b-5p to regulate EEF1A1. Shi N, Zhang S, Guo Y, Yu X, Zhao W, Zhang M, Guan Z, Duan M. Vet Microbiol. 2021 Mar;254:108995.

  • Clinical significance of miR-33b in glioma and its regulatory role in tumor cell proliferation, invasion and migration. Qi Y, Gao Y. Biomark Med. 2020 May;14(7):539-548.

  • Linc02349 promotes osteogenesis of human umbilical cord-derived stem cells by acting as a competing endogenous RNA for miR-25-3p and miR-33b-5p. Cao L, Liu W, Zhong Y, Zhang Y, Gao D, He T, Liu Y, Zou Z, Mo Y, Peng S, Shuai C. Cell Prolif. 2020 May;53(5):e12814.

  • Protein arginine methyltransferase 5 represses tumor suppressor miRNAs that down-regulate CYCLIN D1 and c-MYC expression in aggressive B-cell lymphoma. Karkhanis V, Alinari L, Ozer HG, Chung J, Zhang X, Sif S, Baiocchi RA. J Biol Chem. 2020 Jan 31;295(5):1165-1180.

  • Up-regulated microRNA-33b inhibits epithelial-mesenchymal transition in gallbladder cancer through down-regulating CROCC. Xu G, Wei X, Tu Q, Zhou C. Biosci Rep. 2020 Jan 31;40(1):BSR20190108.

  • Metformin reduces lipid accumulation in HepG2 cells via downregulation of miR-33b. Zare M, Panahi G, Koushki M, Mostafavi-Pour Z, Meshkani R. Arch Physiol Biochem. 2022 Apr;128(2):333-340.

  • Long noncoding RNA HIF1A-AS2 facilitates cell survival and migration by sponging miR-33b-5p to modulate SIRT6 expression in osteosarcoma. Lin H, Zhao Z, Hao Y, He J, He J. Biochem Cell Biol. 2020 Apr;98(2):284-292.

  • MiR-33b-3p promotes chondrocyte proliferation and inhibits chondrocyte apoptosis and cartilage ECM degradation by targeting DNMT3A in osteoarthritis. Ma F, Li G, Yu Y, Xu J, Wu X. Biochem Biophys Res Commun. 2019 Nov 5;519(2):430-437.

  • Identification of Differential Roles of MicroRNA-33a and -33b During Atherosclerosis Progression With Genetically Modified Mice. Koyama S, Horie T, Nishino T, Baba O, Sowa N, Miyasaka Y, Kuwabara Y, Nakao T, Nishiga M, Nishi H, Nakashima Y, Nakazeki F, Ide Y, Kimura M, Tsuji S, Ruiz Rodriguez R, Xu S, Yamasaki T, Otani C, Watanabe T, Nakamura T, Hasegawa K, Kimura T, Ono K. J Am Heart Assoc. 2019 Jul 2;8(13):e012609.

  • MicroRNA-33b regulates sensitivity to daunorubicin in acute myelocytic leukemia by regulating eukaryotic translation initiation factor 5A-2. Liu Y, Lei P, Qiao H, Sun K, Lu X, Bao F, Yu R, Lian C, Li Y, Chen W, Xue F. J Cell Biochem. 2020 Jan;121(1):385-393.

    • There are 60 references associated with hsa-miR-33b-5p. Click here to see the complete list in PubMed.