Mature miRNA: hsa-miR-3187-3p

Mature miRNA

miRNA Name hsa-miR-3187-3p
Previous Name hsa-miR-3187
miRNA Sequence 5' - uuggccauggggcugcgcgg - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0015069

Precursor miRNA

Precursor Name hsa-mir-3187
Genomic Location chr19:813584-813653 (+); nearby genomic features
Clustered miRNAs hsa-mir-4745,hsa-mir-3187 (within 10kb in genome)
NCBI GENE ID 100422854
miRBase ID MI0014231
Precursor Sequence 
          g     -gu      g    ucacc
gcuggcccug gcagc   guggcu aagg     a
|||||||||| |||||   |||||| ||||     
cgaccggggc cgucg   uaccgg uucc     u
          g     ggg      -    ucuug

References

  • CircCDC6 restrains tumor growth and glycolysis energy metabolism in colorectal cancer via regulating miR-3187-3p and downstream PRKAA2. Zhao C, Chen H, Min K. J Bioenerg Biomembr. 2022 Jun;54(3):163-174.

  • Long non-coding RNA H19 promotes the proliferation, migration and invasion while inhibits apoptosis of hypertrophic scarring fibroblasts by targeting miR-3187-3p/GAB1 axis. Xiao M, Zou X, Li B, Zhang B. Burns. 2021 May;47(3):654-664.

  • Circulating serum exosomal miR-20b-5p and miR-3187-5p as efficient diagnostic biomarkers for early-stage non-small cell lung cancer. Zhang ZJ, Song XG, Xie L, Wang KY, Tang YY, Yu M, Feng XD, Song XR. Exp Biol Med (Maywood). 2020 Oct;245(16):1428-1436.

  • RIG-I regulates myeloid differentiation by promoting TRIM25-mediated ISGylation. Wu SF, Xia L, Shi XD, Dai YJ, Zhang WN, Zhao JM, Zhang W, Weng XQ, Lu J, Le HY, Tao SC, Zhu J, Chen Z, Wang YY, Chen S. Proc Natl Acad Sci U S A. 2020 Jun 23;117(25):14395-14404.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Characterization of the Melanoma miRNAome by Deep Sequencing. Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK. PLoS One. 2010 Mar 12;5(3):e9685.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.