Mature miRNA: hsa-miR-3131

Mature miRNA

miRNA Name hsa-miR-3131
miRNA Sequence 5' - ucgaggacugguggaagggccuu - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0014996
Similar miRNAs hsa-miR-611 (sharing the same seed sequence with hsa-miR-3131).

Precursor miRNA

Precursor Name hsa-mir-3131
Genomic Location chr2:219058688-219058750 (-); nearby genomic features
NCBI GENE ID 100422957
miRBase ID MI0014151
Precursor Sequence 
   uc    a    u  -a        --  cc
gag  gagg cugg gg  agggccuu  uc  c
|||  |||| |||| ||  ||||||||  ||  
cuc  cuuc gacc cc  ucccggaa  ag  u
   uu    -    -  gg        cc  ac

References

  • The Relationship between Pre-miR-3131 3-bp Insertion/Deletion Polymorphism and Susceptibility and Clinicopathological Characteristics of Patients with Breast Cancer. Azizi M, Rahimi N, Bahari G, Hashemi SM, Hashemi M. Microrna. 2020;9(3):216-223.

  • An indel polymorphism within pre-miR3131 confers risk for hepatocellular carcinoma. Wang C, Li L, Yin Z, Zhang Q, Zhao H, Tao R, Wang S, Hu S, He Y, Wang D, Li C, Zhang S, Xu J, Jiang X, Zhu S, Gao Y. Carcinogenesis. 2017 Feb 1;38(2):168-176.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Characterization of the Melanoma miRNAome by Deep Sequencing. Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK. PLoS One. 2010 Mar 12;5(3):e9685.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.