Mature miRNA: hsa-miR-30a-3p



Mature miRNA

miRNA Name hsa-miR-30a-3p
Previous Name hsa-miR-30a-3p;hsa-miR-30a*
miRNA Sequence 5' - cuuucagucggauguuugcagc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
Targeted Pathways miRDB
Expression Profile Display table
miRBase ID MIMAT0000088
Similar miRNAs hsa-miR-30d-3p, hsa-miR-30e-3p (sharing the same seed sequence with hsa-miR-30a-3p).

Precursor miRNA

Precursor Name hsa-mir-30a
Genomic Location chr6:71403551-71403621 (-); nearby genomic features
NCBI GENE ID 407029
MIM ID 612329
miRBase ID MI0000088
Precursor Sequence
   a            uc           -----   a
gcg cuguaaacaucc  gacuggaagcu     gug a
||| ||||||||||||  |||||||||||     ||| 
cgu gacguuuguagg  cugacuuucgg     cac g
   c            --           guaga   c

References


  • Deciphering the Role of miR-30a-5p and DLGAP1 Gene in Non-small Cell Lung Cancer. Åšwitlik W, Wyżewski Z, Gregorczyk-Zboroch K, Gietler M, Pudlarz A, SzewiÅ„ska J, Orzechowski S, JakieÅ‚a S, Szemraj J. Anticancer Res. 2024 Jun;44(6):2445-2451.

  • MiR-30a-5p isoform -1|1 promotes the progression of gastric cancer by inhibiting TMEM66 and reducing intratumoral cytotoxic T cells. Dai Y, Xu Y, Shen J, Hu C, Li X, Chen Y, Liu Y, Hu D. Exp Cell Res. 2024 Jun 15;439(2):114099.

  • miR-30a-5p attenuates hypoxia/reoxygenation-induced cardiomyocyte apoptosis by regulating PTEN protein expression and activating PI3K/Akt signaling pathway. Liang G, Guo C, Tang H, Zhang M. BMC Cardiovasc Disord. 2024 May 5;24(1):236.

  • Exosomal miR-30a-5p promoted intrahepatic cholangiocarcinoma progression by increasing angiogenesis and vascular permeability in PDCD10 dependent manner. Jiang W, Shi X, Sun L, Zhang Y, Kong X, Yang X, Yin Y, Li C, Li X. Int J Biol Sci. 2023 Aug 28;19(14):4571-4587.

  • MiR-30a inhibits silica dust-induced epithelial-mesenchymal transition by targeting Snail. Huang F, Li Y, Guan L, Hu Y, Zeng M. Toxicol In Vitro. 2023 Oct;92:105657.

  • Tumor-suppressive action of miR-30a-5p in lung adenocarcinoma correlates with ABL2 inhibition and PI3K/AKT pathway inactivation. Miao Y, Liu J. Clin Transl Oncol. 2024 Feb;26(2):398-413.

  • MiR-30a-5p Enhances Cisplatin Sensitivity by Downregulating RIF1 in Ovarian Cancer. Yao W, Wang Y, Huang M, Zhou J, Zheng R, Jin C, Zhang Y. Ann Clin Lab Sci. 2023 May;53(3):418-426.

  • MiR-30a-5p inhibits cell behaviors in esophageal cancer via modulating CBX2. Peng L, Huang X, Qing D, Lu H, Liu X, Chen J, Long X, Pang Q. Mutat Res. 2023 Jan-Jun;826:111818.

  • MiR-30a-5p/CHD1 axis enhances cisplatin sensitivity of ovarian cancer cells via inactivating the Wnt/β-catenin pathway. Wang X, Zhao H, Wang P, Zhang J, Li N, Liu Y, Zhang F, Yu Y. Anticancer Drugs. 2022 Nov 1;33(10):989-998.

  • MiR-30a-3p Targeting FLT1 Modulates Trophoblast Cell Proliferation in the Pathogenesis of Preeclampsia. Wang Y, Wang L, Yu X, Gong W. Horm Metab Res. 2022 Sep;54(9):633-640.

  • Characterization of plasma exosomal microRNAs in responding to radiotherapy of human esophageal squamous cell carcinoma. Miao N, Cai W, Ding S, Liu Y, Chen W, Sun T. Mol Med Rep. 2022 Sep;26(3):287.

  • [Contents of BDNF, miR-30a-5p and miR-122 during alcohol withdrawal syndrome]. Peregud DI, Korolkov AI, Baronets VY, Lobacheva AS, Arkus ML, Igumnov SA, Pirozhkov SV, Terebilina NN. Biomed Khim. 2022 Jun;68(3):218-227.

  • miR-30 inhibits the progression of osteosarcoma by targeting MTA1. Zhao A, Zhao Y, Feng W, Zhao Z, Liu W, Wang N, Xue H, Wu L, Cui S, Bai R. J Musculoskelet Neuronal Interact. 2022 Jun 1;22(2):261-268.

  • miR-30a Serves as a Tumor Suppressor for Hepatocellular Carcinoma by Downregulating ADAMTS14. Wang HM, Fu LL, Cui YX. Clin Lab. 2022 May 1;68(5).

  • MiR-30a-3p Suppresses the Growth and Development of Lung Adenocarcinoma Cells Through Modulating GOLM1/JAK-STAT Signaling. Ding D, Zhang Y, Zhang X, Shi K, Shang W, Ying J, Wang L, Chen Z, Hong H. Mol Biotechnol. 2022 Oct;64(10):1143-1151.

  • The Role of lncRNA Chen W, Fan D, Guo B, Liu S, Li Z, Duan J, Fang C, Liu Y, Chen L. Ann Clin Lab Sci. 2022 Mar;52(2):292-300.

  • Suppression of bone remodeling associated with long-term bisphosphonate treatment is mediated by microRNA-30a-5p. Li X, Xu R, Ye JX, Yuan FL. Bioengineered. 2022 Apr;13(4):9741-9753.

  • Small extracellular vesicles derived from patients with persistent atrial fibrillation exacerbate arrhythmogenesis via miR-30a-5p. Mun D, Kim H, Kang JY, Yun N, Youn YN, Joung B. Clin Sci (Lond). 2022 Apr 29;136(8):621-637.

  • LINC00488 Induces Tumorigenicity in Retinoblastoma by Regulating microRNA-30a-5p/EPHB2 Axis. Cui X, Liang T, Ji X, Shao Y, Zhao P, Li X. Ocul Immunol Inflamm. 2023 Apr;31(3):506-514.

  • Long Noncoding RNA FOXD2-AS1 Promotes Pancreas Adenocarcinoma Cell Invasion and Migration by Sponging miR-30a-3p to Upregulate COX-2. Ye Z, Yang Y, Wei Y, Li L, Wang X, Zhang J. Crit Rev Eukaryot Gene Expr. 2022;32(1):25-33.


  • There are 274 references associated with hsa-miR-30a-3p. Click here to see the complete list in PubMed.