Mature miRNA: hsa-miR-25-5p



Mature miRNA

miRNA Name hsa-miR-25-5p
Previous Name hsa-miR-25*
miRNA Sequence 5' - aggcggagacuugggcaauug - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004498

Precursor miRNA

Precursor Name hsa-mir-25
Genomic Location chr7:100093560-100093643 (-); nearby genomic features
Clustered miRNAs hsa-mir-25,hsa-mir-93,hsa-mir-106b (within 10kb in genome)
NCBI GENE ID 407014
MIM ID 612150
miRBase ID MI0000082
Precursor Sequence
    a ug   ag    g     uu g     u   --  ac
ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
|||| |  |||  |||| |||||  | ||||| |||  ||   c
ccgg c  gac  ucug cucug  c cguua cgg  cc  u
    c gu   ag    g     uu a     -   gu  cg

References


  • Hypoxic glioma-derived exosomal miR-25-3p promotes macrophage M2 polarization by activating the PI3K-AKT-mTOR signaling pathway. Xue Z, Liu J, Xing W, Mu F, Wu Y, Zhao J, Liu X, Wang D, Wang J, Li X, Wang J, Huang B. J Nanobiotechnology. 2024 Oct 16;22(1):628.

  • miR‑25‑3p serves as an oncogenic in colorectal cancer cells by regulating the ubiquitin ligase FBXW7 function. Chen Y, Chen B, Tu S, Yuan H. Oncol Rep. 2024 Nov;52(5):153.

  • Enhancement of endothelial function and attenuation of portal vein injury using mesenchymal stem cells carrying miRNA-25-3p. Nie G, Zhang H, Luo W, Zhu X, Xie D, Yan J, Wang H, Li X. Sci Rep. 2024 Jul 2;14(1):15113.

  • Next-generation sequencing reveals that miR-16-5p, miR-19a-3p, miR-451a, and miR-25-3p cargo in plasma extracellular vesicles differentiates sedentary young males from athletes. Fernandez-Sanjurjo M, Pinto-Hernandez P, Dávalos A, Díaz-Martínez ÁE, Martín-Hernández R, Castilla-Silgado J, Toyos-Rodríguez C, Whitham M, Amado-Rodríguez L, Muñiz-Albaiceta G, Terrados N, Fernández-García B, Iglesias-Gutiérrez E. Eur J Sport Sci. 2024 Jun;24(6):766-776.

  • Overexpression of miR-25 Downregulates the Expression of ROBO2 in Idiopathic Intellectual Disability. Ordoñez-Razo RM, Gutierrez-López Y, Araujo-Solis MA, Benitez-King G, Ramírez-Sánchez I, Galicia G. Int J Mol Sci. 2024 Apr 2;25(7):3953.

  • Lnc NR2F1-AS1 Promotes Breast Cancer Metastasis by Targeting the MiR-25-3p/ZEB2 Axis. Zhai D, Zhou Y, Kuang X, Shao F, Zhen T, Lin Y, Wang Q, Shao N. Int J Med Sci. 2023 Jul 24;20(9):1152-1162.

  • LncRNA XIST Exacerbates Oxygen-Glucose Deprivation/Reoxygenation-Induced Cerebral Injury Through the miR-25-3p/TRAF3 Axis. Li Y, Zhang JK, Yu ZT, Jiang JW, Tang H, Tu GL, Xia Y. Mol Neurobiol. 2023 Oct;60(10):6109-6120.

  • miR-25 promotes cell migration and invasion by inhibiting the expression of CDH1 in rectal carcinoma. Xu X, Jiang D, Lin F, Li S. Asian J Surg. 2023 Nov;46(11):4796-4797.

  • Expression of mir-25-3p, CARD9 and Surviving in Acute Pancreatitis and Predictive Value for Patient Outcome. Fang N, Ding Y, Yang W. Cell Mol Biol (Noisy-le-grand). 2023 Jan 31;69(1):30-35.

  • Diagnostic value of serum miR-25-3p in hypertensive disorders in pregnancy. Zhou D, Qu B, Zhang X. Women Health. 2022 Oct-Dec;62(9-10):818-826.

  • microRNA-25-3p suppresses osteogenic differentiation of BMSCs in patients with osteoporosis by targeting ITGB3. Yu D, Li Z, Cao J, Shen F, Wei G. Acta Histochem. 2022 Aug;124(6):151926.

  • The Relationship and Expression of Nothnick WB, Peterson R, Minchella P, Falcone T, Graham A, Findley A. Int J Mol Sci. 2022 May 24;23(11):5862.

  • PCAT19 Regulates the Proliferation and Apoptosis of Lung Cancer Cells by Inhibiting miR-25-3p via Targeting the MAP2K4 Signal Axis. Wang B, Yang S, Jia Y, Yang J, Du K, Luo Y, Li Y, Wang Z, Liu Y, Zhu B. Dis Markers. 2022 May 16;2022:2442094.

  • Mir-25 Promotes Metastasis of Esophageal Cancer by Targeting BTG2. Guo B, Tian Z. Appl Biochem Biotechnol. 2023 Sep;195(9):5365-5378.

  • Investigation of miR-21-5p Key Target Genes and Pathways in Head and Neck Squamous Cell Carcinoma Based on TCGA Database and Bioinformatics Analysis. Shen M, Zhou Z, Li BB, Lv M, Feng C, Chen S, Shi S, Kang M, Zhao T. Technol Cancer Res Treat. 2022 Jan-Dec;21:15330338221081245.

  • miR-25 and miR-92b regulate insulin biosynthesis and pancreatic β-cell apoptosis. Shen Z, Yu Y, Yang Y, Xiao X, Sun T, Chang X, Tang W, Zhu Y, Han X. Endocrine. 2022 Jun;76(3):526-535.

  • Effect of Salivary Exosomal miR-25-3p on Periodontitis With Insulin Resistance. Byun JS, Lee HY, Tian J, Moon JS, Choi J, Lee SH, Kim YG, Yi HS. Front Immunol. 2022 Jan 7;12:775046.

  • Overexpression of microRNAs miR-25-3p, miR-185-5p and miR-132-3p in Late Onset Fetal Growth Restriction, Validation of Results and Study of the Biochemical Pathways Involved. Loscalzo G, Scheel J, Ibañez-Cabellos JS, García-Lopez E, Gupta S, García-Gimenez JL, Mena-Mollá S, Perales-Marín A, Morales-Roselló J. Int J Mol Sci. 2021 Dec 28;23(1):293.

  • lnc‑MICAL2‑1 sponges miR‑25 to regulate DKK3 expression and inhibits activation of the Wnt/β‑catenin signaling pathway in breast cancer. Yao J, Li G, Liu M, Yang S, Su H, Ye C. Int J Mol Med. 2022 Feb;49(2):23.

  • LncRNA OIP5-AS1 accelerates intervertebral disc degeneration by targeting miR-25-3p. Che Z, Xueqin J, Zhang Z. Bioengineered. 2021 Dec;12(2):11201-11212.


  • There are 143 references associated with hsa-miR-25-5p. Click here to see the complete list in PubMed.