Mature miRNA: hsa-miR-216b-5p

Mature miRNA

miRNA Name hsa-miR-216b-5p
miRNA Sequence 5' - aaaucucugcaggcaaauguga - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004959

Precursor miRNA

Precursor Name hsa-mir-216b
Genomic Location chr2:56000714-56000795 (-); nearby genomic features
NCBI GENE ID 100126319
miRBase ID MI0005569
Precursor Sequence 
--g       gaa         a  --caaa      g  ac
   cagacug   aaucucugc gg      ugugau uc  u
   |||||||   ||||||||| ||      |||||| ||  
   gucugac   uuagagaug cc      acacua ag  g
aca       auc         c  auucac      a  ga

References

  • [LncRNA RPL22P1-201 affects prostate cancer cell proliferation, cell cycle, and sensitivity to docetaxel by regulating miR-216b-5p expression]. Yang C, Xue JG. Zhonghua Nan Ke Xue. 2023 Oct;29(10):881-887.

  • LncRNA-SNHG1 promotes paclitaxel resistance of gastric cancer cells through modulating the miR-216b-5p-hexokianse 2 axis. Xu J, Xu Y, Ye G, Qiu J. J Chemother. 2023 Oct;35(6):527-538.

  • Ultrasound microbubbles-mediated miR-216b affects MALAT1-miRNA axis in non-small cell lung cancer cells. Wang J, Mo J, Xie Y, Wang C. Tissue Cell. 2022 Feb;74:101703.

  • The expression of miRNA-216b is negatively correlated with 18F-FDG uptake in non-small cell lung cancer. Zuo M, Yao L, Wen L, Shen J, Zhang N, Bai T, Huang Q. World J Surg Oncol. 2021 Sep 1;19(1):262.

  • MicroRNA-216b targets Liu T, Ye P, Ye Y, Han B. Int J Biol Sci. 2021 Jul 13;17(11):2970-2983.

  • Long Noncoding RNA LINC01518 Modulates Proliferation and Migration in TGF-β1-Treated Human Tenon Capsule Fibroblast Cells Through the Regulation of hsa-miR-216b-5p. Kong N, Bao Y, Zhao H, Kang X, Tai X, Chen X, Guo W, Shen Y. Neuromolecular Med. 2022 Jun;24(2):88-96.

  • LncRNA MYCNOS promotes glioblastoma cell proliferation by regulating miR-216b/FOXM1 axis. Zhao P, Li T, Wang Y, Wang Y, Gu Q, Li Z. Metab Brain Dis. 2021 Aug;36(6):1185-1189.

  • MiR-216b inhibits gastric cancer proliferation and migration by targeting PARK7. Zhu GM, Chen SQ, Jiang QG, Cao Y, Guo Y, Ye LQ. Indian J Pathol Microbiol. 2021 Jan-Mar;64(1):52-57.

  • MiR-216b regulates the tumorigenesis of gastric cancer by targeting PXN. Liu X, Xu D, Xu X, Xue Q, Gao X, Tang C. Pathol Res Pract. 2021 Feb;218:153325.

  • LncRNA KCNQ1OT1 acts as miR-216b-5p sponge to promote colorectal cancer progression via up-regulating ZNF146. Zhu S, Chen CY, Hao Y. J Mol Histol. 2021 Jun;52(3):479-490.

  • Dysregulation of lnc-SNHG1 and miR-216b-5p correlate with chemoresistance and indicate poor prognosis of serous epithelial ovarian cancer. Pei ML, Zhao ZX, Shuang T. J Ovarian Res. 2020 Dec 10;13(1):144.

  • Correlation between carotid atherosclerotic plaque properties and serum levels of lncRNA CCAT2 and miRNA-216b. Huang CQ, Jin WX, Yu GF. Eur Rev Med Pharmacol Sci. 2020 Jun;24(12):7033-7038.

  • LncRNA GAS5 affects epithelial-mesenchymal transition and invasion of breast cancer cells by regulating miR-216b. Li Y, Guo XB, Wei YH. Eur Rev Med Pharmacol Sci. 2020 May;24(9):4873-4881.

  • Therapeutic targeting of miRNA-216b in cancer. Jana S, Krishna M, Singhal J, Horne D, Awasthi S, Salgia R, Singhal SS. Cancer Lett. 2020 Aug 1;484:16-28.

  • MicroRNA-216b regulates cell proliferation, invasion and cycle progression via interaction with cyclin T2 in gastric cancer. Chen X, Zhang L, Song Q, Chen Z. Anticancer Drugs. 2020 Jul;31(6):623-631.

  • MicroRNA-216b suppresses the cell growth of hepatocellular carcinoma by inhibiting Ubiquitin-specific peptidase 28 expression. Zhang JF. Kaohsiung J Med Sci. 2020 Jun;36(6):423-428.

  • Downregulation of serum exosomal miR-216b predicts unfavorable prognosis in patients with non-small cell lung cancer. Liu W, Liu J, Zhang Q, Wei L. Cancer Biomark. 2020;27(1):113-120.

  • MiR-216b-5p inhibits cell proliferation in human breast cancer by down-regulating HDAC8 expression. Menbari MN, Rahimi K, Ahmadi A, Elyasi A, Darvishi N, Hosseini V, Mohammadi-Yeganeh S, Abdi M. Life Sci. 2019 Nov 15;237:116945.

  • Long non-coding RNA 00152 promotes cell proliferation in cervical cancer via regulating miR-216b-5p/HOXA1 axis. Zheng JJ, Du XJ, Wang HP, Zhou LY, Wang YJ, Zhang L, Xu H, Zhang J, Hu ZF. Eur Rev Med Pharmacol Sci. 2019 May;23(9):3654-3663.

  • MicroRNA therapeutics: design of single-stranded miR-216b mimics to target KRAS in pancreatic cancer cells. Ferino A, Miglietta G, Picco R, Vogel S, Wengel J, Xodo LE. RNA Biol. 2018;15(10):1273-1285.

    • There are 41 references associated with hsa-miR-216b-5p. Click here to see the complete list in PubMed.