Mature miRNA: hsa-miR-20b-5p



Mature miRNA

miRNA Name hsa-miR-20b-5p
Previous Name hsa-miR-20b
miRNA Sequence 5' - caaagugcucauagugcagguag - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0001413
Similar miRNAs hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-miR-17-5p, hsa-miR-20a-5p, hsa-miR-519d-3p, hsa-miR-526b-3p, hsa-miR-93-5p (sharing the same seed sequence with hsa-miR-20b-5p).

Precursor miRNA

Precursor Name hsa-mir-20b
Genomic Location chrX:134169809-134169877 (-); nearby genomic features
Clustered miRNAs hsa-mir-363,hsa-mir-92a-2,hsa-mir-19b-2,hsa-mir-20b,hsa-mir-18b,hsa-mir-106a (within 10kb in genome)
NCBI GENE ID 574032
MIM ID 300950
miRBase ID MI0001519
Precursor Sequence
     -ca           g     -gu    uu
aguac   aagugcucaua ugcag   aguu  g
|||||   ||||||||||| |||||   ||||   g
ucaug   uucacggguau auguc   ucag  c
     acc           g     auc    ua

References


  • Identification of miR-20b-5p as an inhibitory regulator in cardiac differentiation via TET2 and DNA hydroxymethylation. Li KX, Li JR, Zuo SJ, Li X, Chen XT, Xiao PY, Li HT, Sun L, Qian T, Zhang HM, Zhu D, Yu XY, Chen G, Jiang XY. Clin Epigenetics. 2024 Mar 15;16(1):42.

  • The dual role of microRNA (miR)-20b in cancers: Friend or foe? İlhan A, Golestani S, Shafagh SG, Asadi F, Daneshdoust D, Al-Naqeeb BZT, Nemati MM, Khalatbari F, Yaseri AF. Cell Commun Signal. 2023 Jan 30;21(1):26.

  • MEF2C-AS1 regulates its nearby gene MEF2C to mediate cervical cancer cell malignant phenotypes in vitro. Guo Q, Zhang L, Zhao L, Pang X, Wang P, Sun H, Liu S. Biochem Biophys Res Commun. 2022 Dec 3;632:48-54.

  • MicroRNA-20b carried by mesenchymal stem cell-derived extracellular vesicles protects alveolar epithelial type II cells from Mycobacterium tuberculosis infection in vitro. Yan K, Xu G, Li Z. Infect Genet Evol. 2022 Jul;101:105292.

  • Human microRNA (miR-20b-5p) modulates Alzheimer's disease pathways and neuronal function, and a specific polymorphism close to the MIR20B gene influences Alzheimer's biomarkers. Wang R, Chopra N, Nho K, Maloney B, Obukhov AG, Nelson PT, Counts SE, Lahiri DK. Mol Psychiatry. 2022 Feb;27(2):1256-1273.

  • microRNA-20b-5p overexpression combing Pembrolizumab potentiates cancer cells to radiation therapy via repressing programmed death-ligand 1. Jiang K, Zou H. Bioengineered. 2022 Jan;13(1):917-929.

  • CircZNF532 knockdown protects retinal pigment epithelial cells against high glucose-induced apoptosis and pyroptosis by regulating the miR-20b-5p/STAT3 axis. Liang GH, Luo YN, Wei RZ, Yin JY, Qin ZL, Lu LL, Ma WH. J Diabetes Investig. 2022 May;13(5):781-795.

  • Syndecan-2, negatively regulated by miR-20b-5p, contributes to 5-fluorouracil resistance of colorectal cancer cells via the JNK/ERK signaling pathway. Hua R, Zhang Y, Yan X, Tang D, Li X, Ni Q, Wang D, Zhu J. Acta Biochim Biophys Sin (Shanghai). 2021 Nov 10;53(11):1547-1557.

  • LncRNA Xu YJ, Zhao JM, Ni XF, Wang W, Hu WW, Wu CP. Epigenomics. 2021 Aug;13(16):1281-1297.

  • Long non-coding RNA COL4A2-AS1 facilitates cell proliferation and glycolysis of colorectal cancer cells via miR-20b-5p/hypoxia inducible factor 1 alpha subunit axis. Yu Z, Wang Y, Deng J, Liu D, Zhang L, Shao H, Wang Z, Zhu W, Zhao C, Ke Q. Bioengineered. 2021 Dec;12(1):6251-6263.

  • Enhancing the sensitivity of ovarian cancer cells to olaparib via microRNA-20b-mediated cyclin D1 targeting. Zhong Q, Xiong Y, Ling C, Qian Y, Zhao X, Yang H. Exp Biol Med (Maywood). 2021 Jun;246(11):1297-1306.

  • MiR-20b-5p promotes hepatocellular carcinoma cell proliferation, migration and invasion by down-regulating CPEB3. Li Z, Wu L, Tan W, Zhang K, Lin Q, Zhu J, Tu C, Lv X, Jiang C. Ann Hepatol. 2021 Jul-Aug;23:100345.

  • The identify role and molecular mechanism of the MALAT1/hsa-mir-20b-5p/TXNIP axis in liver inflammation caused by CHB in patients with chronic HBV infection complicated with NAFLD. Li JZ, Ye LH, Wang DH, Zhang HC, Li TY, Liu ZQ, Dai EH, Li MR. Virus Res. 2021 Jun;298:198405.

  • lncRNA DUXAP8 inhibits papillary thyroid carcinoma cell apoptosis via sponging the miR‑20b‑5p/SOS1 axis. Pang R, Yang S. Oncol Rep. 2021 May;45(5):64.

  • Long non-coding RNA HOTAIR knockdown alleviates gouty arthritis through miR-20b upregulation and NLRP3 downregulation. Liu YF, Xing GL, Chen Z, Tu SH. Cell Cycle. 2021 Feb;20(3):332-344.

  • MiR-20b is implicated in preeclampsia progression via the regulation of myeloid cell leukemin-1. Zhang SS, Kan XQ, Liu P, Yin LZ, Li QY, Xu HY. J Biol Regul Homeost Agents. 2020 Sep-Oct;34(5):1709-1717.

  • miR-20b-5p functions as tumor suppressor microRNA by targeting cyclinD1 in colon cancer. Yang H, Lin J, Jiang J, Ji J, Wang C, Zhang J. Cell Cycle. 2020 Nov;19(21):2939-2954.

  • LncRNA WWOX-AS1 sponges miR-20b-5p in hepatocellular carcinoma and represses its progression by upregulating WWOX. Xu D, Liu X, Wu J, Wang Y, Zhou K, Chen W, Chen J, Chen C, Chen L. Cancer Biol Ther. 2020 Oct 2;21(10):927-936.

  • Assessment of circulating miR-20b, miR-221, and miR-155 in occupationally lead-exposed workers of North-Western India. Mitra P, Goyal T, Singh P, Sharma S, Sharma P. Environ Sci Pollut Res Int. 2021 Jan;28(3):3172-3181.

  • High expression of microRNA20b is associated with malignant clinicopathological features and poor prognosis in breast phyllodes tumor. Lei T, Yin L, Zhang H, Wei B, Chen H, Pu T, Yang L, Ye F, Zhang Z, Bu H. Int J Clin Oncol. 2020 Dec;25(12):2025-2034.


  • There are 85 references associated with hsa-miR-20b-5p. Click here to see the complete list in PubMed.