Mature miRNA: hsa-miR-184

Mature miRNA

miRNA Name hsa-miR-184
miRNA Sequence 5' - uggacggagaacugauaagggu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
Expression Profile Display table
miRBase ID MIMAT0000454

Precursor miRNA

Precursor Name hsa-mir-184
Genomic Location chr15:79209788-79209871 (+); nearby genomic features
NCBI GENE ID 406960
MIM ID 613146
miRBase ID MI0000481
Precursor Sequence 
c       g c         c      a c     -    ug
 cagucac u cccuuauca uuuucc g ccagc uuug  a
 ||||||| | ||||||||| |||||| | ||||| ||||  
 guuagug a gggaauagu aagagg c gguug gaau  c
a       g u         c      - a     u    gu

References

  • Effect of miR-184 on Multiple Myeloma by Targeting Notch1. Li L, Yang B, Wu C. Ann Clin Lab Sci. 2024 Jul;54(4):533-538.

  • Molecular analyses of exosome-derived miRNAs revealed reduced expression of miR-184-3p and decreased exosome concentration in patients with alveolar echinococcosis. Cui Z, Yu W, Wang Z, Kong F, Ye G, Yan J, Wu D, Du F, Pang M, Shi D, Ren L. Exp Parasitol. 2024 May;260:108734.

  • Downregulating miR-184 relieves calcium oxalate crystal-mediated renal cell damage via activating the Rap1 signaling pathway. Han M, Zhang D, Ji J, Zhang J, Qin M. Aging (Albany NY). 2023 Dec 27;15(24):14749-14763.

  • Evaluation of Diagnostic Significance of Salivary miRNA-184 and miRNA-21 in Oral Squamous Cell Carcinoma and Oral Potentially Malignant Disorders. Garg A, Urs AB, Koner BC, Augustine J, Guru SA. Head Neck Pathol. 2023 Dec;17(4):961-968.

  • microRNA-184 in the landscape of human malignancies: a review to roles and clinical significance. Fattahi M, Rezaee D, Fakhari F, Najafi S, Aghaei-Zarch SM, Beyranvand P, Rashidi MA, Bagheri-Mohammadi S, Zamani-Rarani F, Bakhtiari M, Bakhtiari A, Falahi S, Kenarkoohi A, Majidpoor J, Nguyen PU. Cell Death Discov. 2023 Nov 24;9(1):423.

  • MiR-184 targeting FOXO1 regulates host-cell oxidative stress induced by Chen L, Huang Q, Luo Y, Zhou Y, Tong T, Chen Y, Bai Q, Lu C, Li Z. Infect Immun. 2023 Nov 16;91(11):e0033723.

  • Exosomal miR-184 in the aqueous humor of patients with central serous chorioretinopathy: a potential diagnostic and prognostic biomarker. Yang JM, Kim SJ, Park S, Son W, Kim A, Lee J. J Nanobiotechnology. 2023 Jul 28;21(1):242.

  • Upregulation of miR-184 and miR-19a-3p induces endothelial dysfunction by targeting AGO2 in Kawasaki disease. Liao J, Guo X, Fan X, Zhang X, Xu M. Cardiol Young. 2023 Oct;33(10):1962-1966.

  • Evaluation of Serum MiR-184 and MiR-326 Expression in PCOS Subjects: Correlation with PCOS Related Parameters. Gao C, Guo L, Jiang Z, Cao L. Clin Lab. 2022 Jul 1;68(7).

  • Combining plasma extracellular vesicle Let-7b-5p, miR-184 and circulating miR-22-3p levels for NSCLC diagnosis and drug resistance prediction. Vadla GP, Daghat B, Patterson N, Ahmad V, Perez G, Garcia A, Manjunath Y, Kaifi JT, Li G, Chabu CY. Sci Rep. 2022 Apr 23;12(1):6693.

  • Are miRNAs Dynamic Biomarkers in Keratoconus? A Review of the Literature. Stunf Pukl S. Genes (Basel). 2022 Mar 25;13(4):588.

  • Circular RNA CircITCH (has-circ-0001141) suppresses hepatocellular carcinoma (HCC) progression by sponging miR-184. Guo X, Wang Z, Deng X, Lu Y, Huang X, Lin J, Lan X, Su Q, Wang C. Cell Cycle. 2022 Aug;21(15):1557-1577.

  • Circulating miR-184 is a potential predictive biomarker of cardiac damage in Anderson-Fabry disease. Salamon I, Biagini E, Kunderfranco P, Roncarati R, Ferracin M, Taglieri N, Nardi E, Laprovitera N, Tomasi L, Santostefano M, Ditaranto R, Vitale G, Cavarretta E, Pisani A, Riccio E, Aiello V, Capelli I, La Manna G, Galiè N, Spinelli L, Condorelli G. Cell Death Dis. 2021 Dec 11;12(12):1150.

  • lncRNA SNHG11 facilitates prostate cancer progression through the upregulation of IGF‑1R expression and by sponging miR‑184. Xie Q, Zhao S, Kang R, Wang X. Int J Mol Med. 2021 Sep;48(3):182.

  • [The miR-184 level in the seminal plasma exosome of male infertility patients and its clinical significance]. Zhu YY, Bian YY, Gu WJ, Ni WH, Wang C, Zhang CN, Liang GY. Zhonghua Nan Ke Xue. 2020 Aug;26(8):686-694.

  • LncRNA LncOGD-1006 alleviates OGD-induced ischemic brain injury regulating apoptosis through miR-184-5p/CAAP1 axis. Chen JY, Chen H, Li T, Yang L, Ye XM, Gao WY, Zhang SP, Zong L. Eur Rev Med Pharmacol Sci. 2020 Dec;24(23):12324-12333.

  • Circ_0025033 promotes the progression of ovarian cancer by activating the expression of LSM4 via targeting miR-184. Hou W, Zhang Y. Pathol Res Pract. 2021 Jan;217:153275.

  • Circular RNA circ-102,166 acts as a sponge of miR-182 and miR-184 to suppress hepatocellular carcinoma proliferation and invasion. Li R, Deng Y, Liang J, Hu Z, Li X, Liu H, Wang G, Fu B, Zhang T, Zhang Q, Yang Y, Chen G, Liu W. Cell Oncol (Dordr). 2021 Apr;44(2):279-295.

  • Circ_0004913 Inhibits Cell Growth, Metastasis, and Glycolysis by Absorbing miR-184 to Regulate Wu M, Sun T, Xing L. Cancer Biother Radiopharm. 2023 Dec;38(10):708-719.

  • miR-184 targets TP63 to block idiopathic pulmonary fibrosis by inhibiting proliferation and epithelial-mesenchymal transition of airway epithelial cells. Li J, Pan C, Tang C, Tan W, Zhang W, Guan J. Lab Invest. 2021 Feb;101(2):142-154.

    • There are 83 references associated with hsa-miR-184. Click here to see the complete list in PubMed.