Mature miRNA: hsa-miR-181b-5p

Mature miRNA

miRNA Name hsa-miR-181b-5p
Previous Name hsa-miR-181b
miRNA Sequence 5' - aacauucauugcugucggugggu - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000257
Similar miRNAs hsa-miR-181a-5p, hsa-miR-181c-5p, hsa-miR-181d-5p, hsa-miR-4262 (sharing the same seed sequence with hsa-miR-181b-5p).

Precursor miRNA

Precursor Name hsa-mir-181b-1
Genomic Location chr1:198858873-198858982 (-); nearby genomic features
Clustered miRNAs hsa-mir-181b-1,hsa-mir-181a-1 (within 10kb in genome)
NCBI GENE ID 406955
MIM ID 612744
miRBase ID MI0000270
Precursor Sequence 
ccugu  agagauuauuuuuuaaaa       aucaa         cug          gaa  g
     gc                  ggucaca     cauucauug   ucgguggguu   cu u
     ||                  |||||||     |||||||||   ||||||||||   || 
     cg                  ccggugu     guaaguaac   agucacucga   gg g
---uu  ----------------cc       -caac         --a          aca  u
Precursor Name hsa-mir-181b-2
Genomic Location chr9:124693710-124693798 (+); nearby genomic features
Clustered miRNAs hsa-mir-181a-2,hsa-mir-181b-2 (within 10kb in genome)
NCBI GENE ID 406956
MIM ID 612745
miRBase ID MI0000683
Precursor Sequence 
cuga   -     cucaa         cu           u  gu
    ugg cugca     cauucauug  gucgguggguu ga  c
    ||| |||||     |||||||||  ||||||||||| ||   u
    acc ggcgu     guaaguaac  uagucacucaa cu  g
acaa   a     caaac         --           -  aa

References

  • MicroRNA-181b-5p Facilitates Thyroid Cancer Growth via Targeting Programmed Cell Death 4. Geng X, Li Y, Sun Y, Cao L, Song Z. Mol Biotechnol. 2024 May;66(5):1154-1164.

  • MicroRNA-181b attenuates lipopolysaccharide-induced inflammatory responses in pulpitis via the PLAU/AKT/NF-κB axis. Meng T, Liu X, Zhang J, Li S, He W, Li W. Int Immunopharmacol. 2024 Jan 25;127:111451.

  • [miR-181b-5p promotes cell proliferation and induces apoptosis in human acute myeloid leukemia by targeting PAX9]. Li B, Tao Q, Hu X, Li T, Bao Y. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2023 Dec;39(12):1074-1082.

  • Upregulating miR-181b promotes ferroptosis in osteoarthritic chondrocytes by inhibiting SLC7A11. Wang D, Fang Y, Lin L, Long W, Wang L, Yu L, Deng H, Wang D. BMC Musculoskelet Disord. 2023 Nov 7;24(1):862.

  • Changes in Serum LncRNA MEG3/miR-181b and UCH-L1 Levels in Patients with Moderate and Severe Intracerebral Hemorrhage. Wang H, Wang L, Shi Q. Turk Neurosurg. 2024;34(1):20-27.

  • Exosomes of A549 Cells Induced Migration, Invasion, and EMT of BEAS-2B Cells Related to let-7c-5p and miR-181b-5p. Liu Y, Su CY, Yan YY, Wang J, Li JJ, Fu JJ, Wang YQ, Zhang JY. Front Endocrinol (Lausanne). 2022 Jul 8;13:926769.

  • MiR-181b Inhibits the Proliferation of Lymphoma Rajixi Cell Line by Regulating the Expression of Target Gene FAMLF. Lu J, Huang X, Wang L, Li Y. Cell Mol Biol (Noisy-le-grand). 2022 Feb 27;67(6):11-17.

  • SNP rs322931 (C>T) in miR-181b and rs7158663 (G>A) in MEG3 aggravate the inflammatory response of anal abscess in patients with Crohn's disease. Zhong C, Yao Q, Han J, Yang J, Jiang F, Zhang Q, Zhou H, Hu Y, Wang W, Zhang Y, Sun Y. Aging (Albany NY). 2022 Apr 14;14(7):3313-3324.

  • MicroRNA-181b-2 and MicroRNA-21-1 Negatively Regulate NF-κB and IRF3-Mediated Innate Immune Responses Sun Y, Zhang L, Hong L, Zheng W, Cui J, Liu X, Xu T. Front Immunol. 2021 Dec 9;12:734520.

  • Extracellular vesicles carrying miRNA-181b-5p affects the malignant progression of acute lymphoblastic leukemia. Yan W, Song L, Wang H, Yang W, Hu L, Yang Y. J Transl Med. 2021 Dec 18;19(1):511.

  • A circular RNA, circSMARCA5, inhibits prostate cancer proliferative, migrative, and invasive capabilities via the miR-181b-5p/miR-17-3p-TIMP3 axis. Xie X, Sun FK, Huang X, Wang CH, Dai J, Zhao JP, Fang C, He W. Aging (Albany NY). 2021 Aug 13;13(15):19908-19919.

  • MicroRNA-181b Serves as a Circulating Biomarker and Regulates Inflammation in Heart Failure. Yang H, Shan L, Gao Y, Li L, Xu G, Wang B, Yin X, Gao C, Liu J, Yang W. Dis Markers. 2021 Jul 1;2021:4572282.

  • miR-181b-5p Promotes the Progression of Cholangiocarcinoma by Targeting PARK2 via PTEN/PI3K/AKT Signaling Pathway. Jiang ZL, Zhang FX, Zhan HL, Yang HJ, Zhang SY, Liu ZH, Jiang Y, Lv LZ, Ke RS. Biochem Genet. 2022 Feb;60(1):223-240.

  • miR-181b and miR-204 suppress the VSMC proliferation and migration by downregulation of HCK. Ghasempour G, Mahabadi VP, Shabani M, Mohammadi A, Zamani-Garmsiri F, Amirfarhangi A, Karimi M, Najafi M. Microvasc Res. 2021 Jul;136:104172.

  • A functional polymorphism of inhibin alpha subunit at miR-181b-1-3p-binding site regulates proliferation and apoptosis of chicken ovarian granular cells. Cui Z, Shen X, Zhang X, Li F, Amevor FK, Zhu Q, Wang Y, Li D, Shu G, Tian Y, Zhao X. Cell Tissue Res. 2021 May;384(2):545-560.

  • miR-96-5p, miR-134-5p, miR-181b-5p and miR-200b-3p heterogenous expression in sites of prostate cancer versus benign prostate hyperplasia-archival samples study. PeÅ‚ka K, Klicka K, Grzywa TM, Gondek A, Marczewska JM, Garbicz F, Szczepaniak K, Paskal W, WÅ‚odarski PK. Histochem Cell Biol. 2021 Mar;155(3):423-433.

  • Potential Diagnostic and Prognostic Utility of miR-141, miR-181b1, and miR-23b in Breast Cancer. Taha M, Mitwally N, Soliman AS, Yousef E. Int J Mol Sci. 2020 Nov 14;21(22):8589.

  • Distinct microRNA profiles for complete hydatidiform moles at risk of malignant progression. Lin LH, Maestá I, St Laurent JD, Hasselblatt KT, Horowitz NS, Goldstein DP, Quade BJ, Sun SY, Braga A, Fisher RA, Berkowitz RS, Elias KM. Am J Obstet Gynecol. 2021 Apr;224(4):372.e1-372.e30.

  • miR‑181b‑5p inhibits trophoblast cell migration and invasion through targeting S1PR1 in multiple abnormal trophoblast invasion‑related events. Miao J, Zhu Y, Xu L, Huang X, Zhou X. Mol Med Rep. 2020 Nov;22(5):4442-4451.

  • Increased expression of plasma hsa-miR-181a in male patients with heroin addiction use disorder. Xu W, Zhao M, Lin Z, Liu H, Ma H, Hong Q, Gui D, Feng J, Liu Y, Zhou W, Liu H. J Clin Lab Anal. 2020 Nov;34(11):e23486.

    • There are 115 references associated with hsa-miR-181b-5p. Click here to see the complete list in PubMed.