Mature miRNA: hsa-miR-152-3p

Mature miRNA

miRNA Name hsa-miR-152-3p
miRNA Sequence 5' - ucagugcaugacagaacuugg - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000438
Similar miRNAs hsa-miR-148a-3p, hsa-miR-148b-3p (sharing the same seed sequence with hsa-miR-152-3p).

Precursor miRNA

Precursor Name hsa-mir-152
Genomic Location chr17:48037161-48037247 (-); nearby genomic features
Clustered miRNAs hsa-mir-10226,hsa-mir-152 (within 10kb in genome)
NCBI GENE ID 406943
MIM ID 613788
miRBase ID MI0000462
Precursor Sequence 
u    cc  c              g  a    cc    cgg   c
 gucc  cc ggcccagguucugu au cacu  gacu   gcu u
 ||||  || |||||||||||||| || ||||  ||||   ||| 
 cagg  gg ccggguucaagaca ua guga  cuga   cga g
c    aa  c              g  c    --    ---   g

References

  • DNMT1/miR-152-3p/SOS1 signaling axis promotes self-renewal and tumor growth of cancer stem-like cells derived from non-small cell lung cancer. Yuan Q, Wang R, Li X, Sun F, Lin J, Fu Z, Zhang J. Clin Epigenetics. 2024 Apr 15;16(1):55.

  • MicroRNA-152 specifically targets kinesin family member 14 to suppress the advancement of bladder cancer cells via PI3K/AKT pathway. Meng F, Zhang Z. Biochem Biophys Res Commun. 2024 Jan 15;692:149337.

  • Tumor-suppressive microRNA-152 inhibits the proliferation of Ewing's sarcoma cells by targeting CDK5R1. Kawano M, Tanaka K, Itonaga I, Iwasaki T, Kubota Y, Tsumura H. Sci Rep. 2023 Oct 29;13(1):18546.

  • Dysregulation of MicroRNA-152-3p is Associated with the Pathogenesis of Pulpitis by Modulating SMAD5. Yu F, Wang P, Gong G. Oral Health Prev Dent. 2023 Jun 5;21:211-218.

  • LncRNA HOTAIRM1 promotes osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by targeting miR-152-3p/ETS1 axis. Wang X, Liu Y, Lei P. Mol Biol Rep. 2023 Jul;50(7):5597-5608.

  • Circ_0000284 facilitates the growth, metastasis and glycolysis of intrahepatic cholangiocarcinoma through miR-152-3p-mediated PDK1 expression. Sun J, Feng M, Zou H, Mao Y, Yu W. Histol Histopathol. 2023 Oct;38(10):1129-1143.

  • [miR-152 inhibits the epithelial-mesenchymal transition and renin-angiotensin system of human hepatocellular carcinoma cells by down-regulating AGTR1]. Quan Y, Yang J, Qin T, Wang X, Hu Y. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2022 Sep;38(9):819-824.

  • m Alvizi L, Brito LA, Kobayashi GS, Bischain B, da Silva CBF, Ramos SLG, Wang J, Passos-Bueno MR. Epigenetics. 2022 Dec;17(13):2278-2295.

  • Mi-RNA-93 and Mi-RNA-152 in the Diagnosis of Type 2 Diabetes and Diabetic Retinopathy. Saleh AA, El-Hefnawy SM, Kasemy ZA, Alhagaa AA, Nooh MZ, Arafat ES. Br J Biomed Sci. 2022 Jan 21;79:10192.

  • Cerebrospinal fluid exosomal miR-152-3p predicts the occurrence of subarachnoid haemorrhage and regulates vascular smooth muscle cell dysfunction. Li Y, Wu A, Dai W, Liu R, Jiang B, Zhou R. Folia Neuropathol. 2022;60(2):185-194.

  • LncRNA-CCAT1/miR-152-3p is involved in CSE-induced inflammation in HBE cells via regulating ERK signaling pathway. Zong D, Liu X, Li J, Long Y, Ouyang R, Chen Y. Int Immunopharmacol. 2022 Aug;109:108818.

  • lncRNA H19 Promotes Ox-LDL-Induced Dysfunction of Human Aortic Endothelial Cells through the miR-152/VEGFA Axis. Tang F, Zhang S, Wang H, Xu S, Yang S, Zhu X, Zeng H, Yang Y. J Healthc Eng. 2022 Mar 19;2022:3795060.

  • MicroRNA-152 Regulates Endometrial Serous Carcinoma Cell Motility by Suppressing Matrix Metalloproteinase 10 Expression. Shigeta S, Watanabe Y, Suzuki F, Nagase S, Shibuya Y, Ishibashi M, Nagai T, Shiga N, Toyoshima M, Tokunaga H, Shimada M, Yaegashi N. Tohoku J Exp Med. 2022 Mar;256(3):249-258.

  • miR-152-3p impedes the malignant phenotypes of hepatocellular carcinoma by repressing roundabout guidance receptor 1. Yin T, Zhao H. Cell Mol Biol Lett. 2022 Mar 2;27(1):22.

  • LncSNHG3 promotes hepatocellular carcinoma epithelial mesenchymal transition progression through the miR-152-3p/JAK1 pathway. Li H, Wu Y, Wang R, Guo J, Yu Q, Zhang L, Zhao H, Yang H. Genes Genomics. 2022 Jan;44(1):133-144.

  • Urinary IgG, serum CX3CL1 and miRNA-152-3p: as predictors of nephropathy in Egyptian type 2 diabetic patients. Abdou AE, Anani HAA, Ibrahim HF, Ebrahem EE, Seliem N, Youssef EMI, Ghoraba NM, Hassan AS, Ramadan MAA, Mahmoud E, Issa S, Maghraby HM, Abdelrahman EK, Hassan HAM. Tissue Barriers. 2022 Jul 3;10(3):1994823.

  • Long noncoding RNA plasmacytoma variant translocation 1 promotes progression of colorectal cancer by sponging microRNA-152-3p and regulating E2F3/MAPK8 signaling. Liu X, Li L, Bai J, Li L, Fan J, Fu Z, Liu J. Cancer Sci. 2022 Jan;113(1):109-119.

  • miR-152-3p aggravates vascular endothelial cell dysfunction by targeting DEAD-box helicase 6 (DDX6) under hypoxia. Zhao Z, Wu C, He X, Zhao E, Hu S, Han Y, Wang T, Chen Y, Liu T, Huang S. Bioengineered. 2021 Dec;12(1):4899-4910.

  • LncRNA CASC2 Alleviates Sepsis-induced Acute Lung Injury by Regulating the miR-152-3p/PDK4 Axis. Zhu L, Shi D, Cao J, Song L. Immunol Invest. 2022 Jul;51(5):1257-1271.

  • Differentially expressed miR-152, a potential biomarker for in-stent restenosis (ISR) in peripheral blood mononuclear cells (PBMCs) of coronary artery disease (CAD) patients. Maheronnaghsh M, Niktab I, Enayati S, Amoli MM, Hosseini SK, Tavakkoly-Bazzaz J. Nutr Metab Cardiovasc Dis. 2021 Apr 9;31(4):1137-1147.

    • There are 149 references associated with hsa-miR-152-3p. Click here to see the complete list in PubMed.