Mature miRNA: hsa-miR-149-5p

Mature miRNA

miRNA Name hsa-miR-149-5p
Previous Name hsa-miR-149
miRNA Sequence 5' - ucuggcuccgugucuucacuccc - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000450

Precursor miRNA

Precursor Name hsa-mir-149
Genomic Location chr2:240456001-240456089 (+); nearby genomic features
NCBI GENE ID 406941
MIM ID 615209
miRBase ID MI0000478
Precursor Sequence 
g     -    g   u u g      g     a     g g   g
 ccggc gccc agc c g cuccgu ucuuc cuccc u cuu u
 ||||| |||| ||| | | |||||| ||||| ||||| | ||| 
 ggucg cggg ucg g c ggggca ggagg gaggg a gag c
a     a    g   u u g      g     -     - g   c

References

  • Distinct Effects of Respiratory Viral Infection Models on miR-149-5p, IL-6 and p63 Expression in BEAS-2B and A549 Epithelial Cells. Shahdab N, Ward C, Hansbro PM, Cummings S, Young JS, Moheimani F. Cells. 2024 May 26;13(11):919.

  • Epigenetic alterations in preeclampsia: a focus on microRNA149 and tetrahydrofolate reductase gene polymorphisms in Egyptian women. Ellakwa DE, Rashed LA, El-Mandoury AA, Younis NF. Ir J Med Sci. 2024 Oct;193(5):2363-2374.

  • LINC01605 promotes malignant phenotypes of cervical cancer via miR-149-3p/WNT7B axis. Kong X, Xiong Y, Li L. Gene. 2024 Aug 30;921:148518.

  • LINC00460 promotes neuroblastoma tumorigenesis and cisplatin resistance by targeting miR-149-5p/DLL1 axis and activating Notch pathway in vitro and in vivo. Xu Y, Qiu Z, Chen J, Huang L, Zhang J, Lin J. Drug Deliv Transl Res. 2024 Jul;14(7):2003-2018.

  • Circ_0008410 contributes to fibroblast-like synoviocytes dysfunction by regulating miR-149-5p/HIPK2 axis. Su W, Ye Z, Wang G, Huang H, Fang Y. Microbiol Immunol. 2024 Mar;68(3):100-110.

  • Update on the association of miR-149 rs2292832 C>T polymorphism with gastric cancer risk: A meta-analysis study of gastrointestinal cancers. Zhong G, Luo X, Li J, Liao Y, Gui G, Sheng J. Medicine (Baltimore). 2023 Sep 22;102(38):e35202.

  • CircUCP2 promotes the tumor progression of non-small cell lung cancer through the miR-149/UCP2 pathway. DU W, Yin F, Zhong Y, Luo M, Wang Z, Lin P, Liu Q, Yang H. Oncol Res. 2023 Sep 15;31(6):929-936.

  • MIR149 rs2292832 and MIR499 rs3746444 Genetic Variants Associated with the Risk of Rheumatoid Arthritis. Ali Y, Chen Y, Islam ZU, Aman A, Almutairi MM, Alouffi A, Mohammed A, Shah AA, Rehman ZU, Hussain I, Ali A, Jalil F. Genes (Basel). 2023 Feb 8;14(2):431.

  • MiR-149-5p inhibits cell proliferation, promotes cell apoptosis and retards cell cycle of IL-22-stimulated HaCaT and NHEK keratinocytes via regulating PDE4D. Hu W, Jiang Y, Wen C, Zeng Y, Jia M. Cytokine. 2023 Apr;164:156123.

  • DDX17 induces epithelial-mesenchymal transition and metastasis through the miR-149-3p/CYBRD1 pathway in colorectal cancer. Zhao G, Wang Q, Zhang Y, Gu R, Liu M, Li Q, Zhang J, Yuan H, Feng T, Ou D, Li S, Li S, Li K, Mo C, Lin P. Cell Death Dis. 2023 Jan 2;14(1):1.

  • MicroRNA-149 Regulates Proliferation, Migration, and Invasion of Pituitary Adenoma Cells by Targeting ADAM12 and MMP14. Zhang Z, Schäfer A, Voellger B, Wang JW, Lei T, Nimsky C, Bartsch JW. Curr Med Sci. 2022 Dec;42(6):1131-1139.

  • The association between genetic variation rs2292832 and the processing efficiency of pre-mir-149 affects the risk of breast cancer. Fakhrezare F, Ebrahimi SO, Reiisi S. Mol Biol Rep. 2023 Jan;50(1):679-685.

  • Association analysis of miRNA-146a and miRNA-499 polymorphisms with rheumatoid arthritis: a case-control and trio-family study. Ul Islam Z, Baneen U, Khaliq T, Nurulain SM, Muneer Z, Hussain S. Clin Exp Med. 2023 Sep;23(5):1667-1675.

  • Tumor-Suppressive and Oncogenic Roles of microRNA-149-5p in Human Cancers. Shen Y, Zhao N, Zhao N, Hu X, He X, Xu Y, Chen J, Chen W, Liu X, Zhou Z, Cao D, Xu X. Int J Mol Sci. 2022 Sep 16;23(18):10823.

  • A role of microRNA-149 in the prefrontal cortex for prophylactic actions of (R)-ketamine in inflammation model. Ma L, Wang L, Chang L, Shan J, Qu Y, Wang X, Fujita Y, Hashimoto K. Neuropharmacology. 2022 Nov 15;219:109250.

  • MicroRNA-149-3p expression correlates with outcomes of adrenocortical tumor patients and affects proliferation and cell cycle progression of H295A adrenocortical cancer cell line. da Silva KR, Veronez LC, Correa CAP, Lira RCP, Baroni M, de Paula Silva Queiroz R, Antonini SRR, Yunes JA, Brandalise SR, Tone LG, Scrideli CA. Hum Cell. 2022 Nov;35(6):1952-1960.

  • Regulation of Iron-Ion Transporter SLC11A2 by Three Identical miRNAs. Sugino Y, Uchiyama R, Shibasaki C, Kugawa F. Biol Pharm Bull. 2022;45(9):1291-1299.

  • YY1-induced DLEU1/miR-149-5p Promotes Malignant Biological Behavior of Cholangiocarcinoma through Upregulating YAP1/TEAD2/SOX2. Li J, Jiang X, Xu Y, Kang P, Huang P, Meng N, Wang H, Zheng W, Wang H, Wang Z, Zhong X, Cui Y. Int J Biol Sci. 2022 Jul 4;18(11):4301-4315.

  • Effects of miRNA-149-5p and Platelet-Activating Factor-Receptor Signaling on the Growth and Targeted Therapy Response on Lung Cancer Cells. Chauhan SJ, Thyagarajan A, Sahu RP. Int J Mol Sci. 2022 Jun 17;23(12):6772.

  • MicroRNA-149 rs2292832 C/T Polymorphism Predicts the Prognosis of Hepatocellular Carcinoma Patients With Bone Metastasis. Feng J, Liu Z, Yu L, Wu C, Luo XB. Lab Med. 2022 Nov 3;53(6):561-569.

    • There are 215 references associated with hsa-miR-149-5p. Click here to see the complete list in PubMed.