Mature miRNA: hsa-miR-146b-5p

Mature miRNA

miRNA Name hsa-miR-146b-5p
Previous Name hsa-miR-146b
miRNA Sequence 5' - ugagaacugaauuccauaggcug - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0002809
Similar miRNAs hsa-miR-146a-5p, hsa-miR-7153-5p (sharing the same seed sequence with hsa-miR-146b-5p).

Precursor miRNA

Precursor Name hsa-mir-146b
Genomic Location chr10:102436512-102436584 (+); nearby genomic features
NCBI GENE ID 574447
MIM ID 610567
miRBase ID MI0003129
Precursor Sequence 
  u      g        au        cu  ga  u
cc ggcacu agaacuga  uccauagg  gu  gc c
|| |||||| ||||||||  ||||||||  ||  || 
gg ccgugg ucuugacu  aggugucc  ua  cg u
  c      -        -c        cg  -a  a

References

  • miR-146a and miR-146b regulate the expression of ICAM-1 in giant cell arteritis. Bonacini M, Rossi A, Ferrigno I, Muratore F, Boiardi L, Cavazza A, Bisagni A, Cimino L, De Simone L, Ghidini A, Malchiodi G, Corbera-Bellalta M, Cid MC, Zerbini A, Salvarani C, Croci S. J Autoimmun. 2024 Apr;144:103186.

  • The miR-146b-3p/TNFAIP2 axis regulates cell differentiation in acute myeloid leukaemia. Lan G, Wu X, Zhao A, Lan J, Guo Q, Wang B, Shen F, Yu X, Zhao Y, Gao R, Xu T. Aging (Albany NY). 2024 Jan 24;16(2):1496-1515.

  • Modulation of miR-146b Expression during Aging and the Impact of Physical Activity on Its Expression and Chondrogenic Progenitors. Dalle Carbonare L, Minoia A, Braggio M, Bertacco J, Piritore FC, Zouari S, Vareschi A, Elia R, Vedovi E, Scumà C, Carlucci M, Bhandary L, Mottes M, Romanelli MG, Valenti MT. Int J Mol Sci. 2023 Aug 24;24(17):13163.

  • miR-146b-5p downregulates IRAK1 and ADAM19 to suppress trophoblast proliferation, invasion, and migration in miscarriage†. Zhang X, Li X, Tan X, Deng L, Zhong L, Wei C, Ruan H, Lu Y, Pang L. Biol Reprod. 2023 Dec 11;109(6):938-953.

  • Clinical Impact of Androgen Receptor-Suppressing miR-146b Expression in Papillary Thyroid Cancer Aggressiveness. Chou CK, Chi SY, Hung YY, Yang YC, Fu HC, Wang JH, Chen CC, Kang HY. J Clin Endocrinol Metab. 2023 Oct 18;108(11):2852-2861.

  • MicroRNA-146b-5p Suppresses Pro-Inflammatory Mediator Synthesis via Targeting TRAF6, IRAK1, and RELA in Lipopolysaccharide-Stimulated Human Dental Pulp Cells. Han P, Sunada-Nara K, Kawashima N, Fujii M, Wang S, Kieu TQ, Yu Z, Okiji T. Int J Mol Sci. 2023 Apr 18;24(8):7433.

  • MiR-146b-5p regulates IL-23 receptor complex expression in chronic lymphocytic leukemia cells. Matis S, Grazia Recchia A, Colombo M, Cardillo M, Fabbi M, Todoerti K, Bossio S, Fabris S, Cancila V, Massara R, Reverberi D, Emionite L, Cilli M, Cerruti G, Salvi S, Bet P, Pigozzi S, Fiocca R, Ibatici A, Angelucci E, Gentile M, Monti P, Menichini P, Fronza G, Torricelli F, Ciarrocchi A, Neri A, Fais F, Tripodo C, Morabito F, Ferrarini M, Cutrona G. Blood Adv. 2022 Oct 25;6(20):5593-5612.

  • miR-146b-5p and miR-520h Expressions Are Upregulated in Serum of Women with Recurrent Spontaneous Abortion. Shahidi M, Nazari F, Ghanbarian H, Taheripanah R, Hajivalili M, Amani D. Biochem Genet. 2022 Oct;60(5):1716-1732.

  • LncRNA DLEU1 is overexpressed in premature ovarian failure and sponges miR-146b-5p to increase granulosa cell apoptosis. Zheng C, Liu S, Qin Z, Zhang X, Song Y. J Ovarian Res. 2021 Nov 5;14(1):151.

  • MicroRNA-146b-5p suppresses cholangiocarcinoma cells by targeting TRAF6 and modulating p53 translocation. Ren Y, Wang X, Ji T, Cai X. Acta Histochem. 2021 Oct;123(7):151793.

  • Mediation of circ_RPPH1 on miR-146b-3p/E2F2 pathway to hinder the growth and metastasis of breast carcinoma cells. Feng H, Sun SZ, Cheng F, Zhang NQ. Aging (Albany NY). 2021 Aug 25;13(16):20552-20568.

  • Dual inhibition of EGFR and IL-6-STAT3 signalling by miR-146b: a potential targeted therapy for epithelial ovarian cancer. Yan M, Han M, Yang X, Shen R, Wang H, Zhang L, Xia S, Yang P, Zhai G, Shao Q. J Enzyme Inhib Med Chem. 2021 Dec;36(1):1905-1915.

  • Targeting the Highly Expressed microRNA miR-146b with CRISPR/Cas9n Gene Editing System in Thyroid Cancer. Santa-Inez DC, Fuziwara CS, Saito KC, Kimura ET. Int J Mol Sci. 2021 Jul 27;22(15):7992.

  • The role of circTMOD3 in regulating LPS-induced acute inflammation and injury in human lung fibroblast WI-38 cells. Ma K, Wang W, Gao C, He J. Exp Lung Res. 2021 Sep;47(7):311-322.

  • MicroRNA-146b-3p regulates the dysfunction of vascular smooth muscle cells via repressing phosphoinositide-3 kinase catalytic subunit gamma. Zhuang X, Gao F, Shi L, Liu W, Wang W, He X, Gao Y. Bioengineered. 2021 Dec;12(1):2627-2638.

  • Comprehensive microRNA and transcriptomic profiling of rheumatoid arthritis monocytes: role of microRNA-146b in pro-inflammatory progression. Ciechomska M, Wojtas B, Bonek K, Roszkowski L, Gluszko P, Benes V, Maslinski W. Rheumatology (Oxford). 2021 Nov 3;60(11):5424-5435.

  • LncRNA NEAT1 Regulates Infantile Pneumonia by Sponging miR-146b. Cui J, Wang J, Lv Y, Xu D. Mol Biotechnol. 2021 Aug;63(8):694-701.

  • Long Noncoding RNA RP11-89K21.1 Interacts with miR-146a/b-5p to Promote Proliferation and Gefitinib Resistance Through Regulating RHPN2 and RhoA/ROCK Pathway in Lung Adenocarcinoma. Chen H, Shen D, Zhu F, Ou Q, Cheng L, Zhu Y. Cancer Biother Radiopharm. 2023 Jun;38(5):282-292.

  • The miR-146b-5p promotes Ewing's sarcoma cells progression via suppressing the expression of BTG2. Qu L, Zhang W, Li J, Liu P. Sci Prog. 2021 Apr-Jun;104(2):368504211002043.

  • Transcription factor SP1-induced microRNA-146b-3p facilitates the progression and metastasis of colorectal cancer via regulating FAM107A. Wang D, Feng M, Ma X, Tao K, Wang G. Life Sci. 2021 Jul 15;277:119398.

    • There are 145 references associated with hsa-miR-146b-5p. Click here to see the complete list in PubMed.