Mature miRNA: hsa-miR-1303

Mature miRNA

miRNA Name hsa-miR-1303
miRNA Sequence 5' - uuuagagacggggucuugcucu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0005891

Precursor miRNA

Precursor Name hsa-mir-1303
Genomic Location chr5:154685776-154685861 (+); nearby genomic features
NCBI GENE ID 100302284
miRBase ID MI0006370
Precursor Sequence 
--    g       u           aa     c     uuuu
  ggcu ggcaaca agcgagaccuc  cucua aauuu    u
  |||| ||||||| |||||||||||  ||||| |||||    
  ucgg ccguugu ucguucugggg  gagau uuaaa    u
uu    a       c           ca     u     uuuu

References

  • hsa_circ_0002980 prevents proliferation, migration, invasion, and epithelial-mesenchymal transition of liver cancer cells through microRNA-1303/cell adhesion molecule 2 axis. Wang Y, Li Z, He J, Chen W, Li Y, Chen X, Liang J, Yu Q, Zhou J. Aging (Albany NY). 2023 Dec 19;15(24):14915-14929.

  • Inhibiting KCNMA1-AS1 promotes osteogenic differentiation of HBMSCs via miR-1303/cochlin axis. Lin Y, Dai H, Yu G, Song C, Liu J, Xu J. J Orthop Surg Res. 2023 Jan 30;18(1):73.

  • Apelin promotes osteosarcoma metastasis by upregulating PLOD2 expression via the Hippo signaling pathway and hsa_circ_0000004/miR-1303 axis. Trang NTN, Lai CY, Tsai HC, Huang YL, Liu SC, Tsai CH, Fong YC, Tzeng HE, Tang CH. Int J Biol Sci. 2023 Jan 1;19(2):412-425.

  • Micro RNA miR-1303 Promotion of Proliferation, Migration and Invasion of Human Liver Cancer Cells Is Enhanced by Low Talin 1 (TLN1) Expression. Huang J, Xi Q, Xiong J, Peng H, Yang H, Sun YU, Hoffman RM. Anticancer Res. 2022 Oct;42(10):4715-4725.

  • Next generation sequencing reveals miR-431-3p/miR-1303 as immune-regulating microRNAs for active tuberculosis. Chen YC, Hsiao CC, Wu CC, Chao TY, Leung SY, Chang YP, Tseng CC, Lee CP, Hsu PY, Wang TY, Wang PW, Chen TW, Lin MC. J Infect. 2022 Nov;85(5):519-533.

  • Circ-SKA3 Enhances Doxorubicin Toxicity in AC16 Cells Through miR-1303/TLR4 Axis. Li B, Cai X, Wang Y, Zhu H, Zhang P, Jiang P, Yang X, Sun J, Hong L, Shao L. Int Heart J. 2021 Sep 30;62(5):1112-1123.

  • Regular football training down-regulates miR-1303 muscle expression in veterans. Mancini A, Vitucci D, Orlandella FM, Terracciano A, Mariniello RM, Imperlini E, Grazioli E, Orrù S, Krustrup P, Salvatore G, Buono P. Eur J Appl Physiol. 2021 Oct;121(10):2903-2912.

  • LncRNA BCRT1 facilitates osteosarcoma progression via regulating miR-1303/FGF7 axis. Han G, Guo Q, Ma N, Bi W, Xu M, Jia J, Wang W. Aging (Albany NY). 2021 Jun 8;13(11):15501-15510.

  • Upregulation of microRNA-1303 is a potential prognostic marker of non-small cell lung cancer. Chen J, Jiang T, Yu B, Li T, Zhao P, Yuan L, Qi J. Cancer Biomark. 2020;28(4):439-446.

  • miR-1303 regulates BBB permeability and promotes CNS lesions following CA16 infections by directly targeting MMP9. Song J, Hu Y, Li H, Huang X, Zheng H, Hu Y, Wang J, Jiang X, Li J, Yang Z, Fan H, Guo L, Shi H, He Z, Yang F, Wang X, Dong S, Li Q, Liu L. Emerg Microbes Infect. 2018 Sep 19;7(1):155.

  • miR-1303 promotes the proliferation of neuroblastoma cell SH-SY5Y by targeting GSK3β and SFRP1. Li Z, Xu Z, Xie Q, Gao W, Xie J, Zhou L. Biomed Pharmacother. 2016 Oct;83:508-513.

  • Increased serum microRNAs are closely associated with the presence of microvascular complications in type 2 diabetes mellitus. Wang C, Wan S, Yang T, Niu D, Zhang A, Yang C, Cai J, Wu J, Song J, Zhang CY, Zhang C, Wang J. Sci Rep. 2016 Feb 1;6:20032.

  • miR-1303 targets claudin-18 gene to modulate proliferation and invasion of gastric cancer cells. Zhang SJ, Feng JF, Wang L, Guo W, Du YW, Ming L, Zhao GQ. Dig Dis Sci. 2014 Aug;59(8):1754-63.

  • Differential expression of microRNAs in plasma of patients with laryngeal squamous cell carcinoma: potential early-detection markers for laryngeal squamous cell carcinoma. Ayaz L, Görür A, YaroÄŸlu HY, Ozcan C, Tamer L. J Cancer Res Clin Oncol. 2013 Sep;139(9):1499-506.

  • Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA. Genome Res. 2008 Apr;18(4):610-21.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.