Mature miRNA: hsa-miR-127-5p

Mature miRNA

miRNA Name hsa-miR-127-5p
miRNA Sequence 5' - cugaagcucagagggcucugau - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004604

Precursor miRNA

Precursor Name hsa-mir-127
Genomic Location chr14:100882979-100883075 (+); nearby genomic features
Clustered miRNAs hsa-mir-337,hsa-mir-665,hsa-mir-431,hsa-mir-433,hsa-mir-127,hsa-mir-432,hsa-mir-136 (within 10kb in genome)
NCBI GENE ID 406914
MIM ID 611709
miRBase ID MI0000472
Precursor Sequence 
-----  u   ca   ucu      ugcug         g  c      --  a
     ug gau  cug   ccagcc     aagcucaga gg ucugau  uc g
     || |||  |||   ||||||     ||||||||| || ||||||  ||  a
     ac cug  ggc   ggucgg     uucgagucu cc aggcua  ag a
cuacu  u   aa   --u      -----         g  u      cu  a

References

  • Hsa_circ_0018401 and miR-127-5p Expressions Are Diagnostic and Prognostic Markers for Traumatic Brain Injury (TBI) in Trauma Patients. Ma X, Wang H, Ye G, Zheng X, Wang Y. Neuroscience. 2024 May 3;545:59-68.

  • miR-127-5p regulates FAIM2-mediated cell apoptosis and participates in cerebral ischemia-reperfusion injury. Hu T, Lin Y. Cell Mol Biol (Noisy-le-grand). 2024 Feb 29;70(2):189-196.

  • MicroRNA-127-3p Inhibits Cardiomyocyte Inflammation and Apoptosis after Acute Myocardial Infarction via Targeting CDKN3. Zhu S, Fang Z. Int Heart J. 2023;64(6):1133-1139.

  • Decreased miR-127 promotes the occurrence of breast cancer via increasing the expression of SPP1. Wei G, Tan M, Wang C, Liang L. Adv Clin Exp Med. 2023 Oct;32(10):1113-1123.

  • Comparison of exosomes secreted by synovial fluid-derived mesenchymal stem cells and adipose tissue-derived mesenchymal stem cells in culture for microRNA-127-5p expression during chondrogenesis. Semerci Sevimli T, Sevimli M, Qomi Ekenel E, AltuÄŸ Tasa B, Nur Soykan M, Demir Güçlüer Z, Ä°nan U, Uysal O, GüneÅŸ Bağış S, Çemrek F, Eker Sarıboyacı A. Gene. 2023 May 20;865:147337.

  • CircSCAPER knockdown attenuates IL-1β-induced chondrocyte injury by miR-127-5p/TLR4 axis in osteoarthritis. Zhang Y, Zhao P, Li S, Mu X, Wang H. Autoimmunity. 2022 Dec;55(8):577-586.

  • miR-127-5p Targets JAM3 to Regulate Ferroptosis, Proliferation, and Metastasis in Malignant Meningioma Cells. Zhang J, Liu Z, Dong Y. Dis Markers. 2022 Jul 2;2022:6423237.

  • LncRNA FOXD3-AS1 promotes breast cancer progression by mediating ARF6. Zhang X, Zhao X, Chang L, Liu F, Li C, Ge P. Breast Cancer. 2022 Sep;29(5):908-920.

  • Hsa_circ_0006732 regulates colorectal cancer cell proliferation, invasion and EMT by miR-127-5p/RAB3D axis. Yang T, Sun J, Wang W, Li D, Yang X, Jia A, Ma Y, Fan Z. Mol Cell Biochem. 2022 Dec;477(12):2751-2760.

  • hsa_circ_0000285 facilitates thyroid cancer progression by regulating miR-127-5p/CDH2. Zhang B, Li Q, Song Z, Ren L, Gu Y, Feng C, Wang J, Liu T. J Clin Lab Anal. 2022 Jul;36(7):e24421.

  • Extracellular vesicle-mediated delivery of miR-127-3p inhibits the proliferation and invasion of choriocarcinoma cells by targeting ITGA6. Ma H, Weng F, Wang L, Tong X, Yao Y, Li H. Exp Cell Res. 2022 May 15;414(2):113098.

  • Downregulation of Renal Hsa-miR-127-3p Contributes to the Overactivation of Type I Interferon Signaling Pathway in the Kidney of Lupus Nephritis. Wu L, Han X, Jiang X, Ding H, Qi C, Yin Z, Xiao J, Xiong L, Guo Q, Ye Z, Qu B, Shen N. Front Immunol. 2021 Oct 21;12:747616.

  • Cellular microRNA-127-3p suppresses oncogenic herpesvirus-induced transformation and tumorigenesis via down-regulation of SKP2. Lee SM, Kaye KM, Slack FJ. Proc Natl Acad Sci U S A. 2021 Nov 9;118(45):e2105428118.

  • Relationship of the Levels of microRNA Gene Methylation with the Level of Their Expression and Pathomorphological Characteristics of Breast Cancer. Filippova EA, Pronina IV, Lukina SS, Kazubskaya TP, Braga EA, Burdennyi AM, Loginov VI. Bull Exp Biol Med. 2021 Oct;171(6):764-769.

  • Circular RNA circLGMN facilitates glioblastoma progression by targeting miR-127-3p/LGMN axis. Chen B, Wang M, Huang R, Liao K, Wang T, Yang R, Zhang W, Shi Z, Ren L, Lv Q, Ma C, Lin Y, Qiu Y. Cancer Lett. 2021 Dec 1;522:225-237.

  • Mesenchymal stem cell-derived exosomes block malignant behaviors of hepatocellular carcinoma stem cells through a lncRNA C5orf66-AS1/microRNA-127-3p/DUSP1/ERK axis. Gu H, Yan C, Wan H, Wu L, Liu J, Zhu Z, Gao D. Hum Cell. 2021 Nov;34(6):1812-1829.

  • Expression of miR-129-2 and miR-127-3p in glioma tissue and the clinical diagnostic value. Xing HS, Liu XD, Zhang L, Liu HY, Du XL, Ma YQ. J Biol Regul Homeost Agents. 2021 Jul 30;35(Special Issue on Internal Medicine n.1).

  • Hsa_circ_0008234 facilitates proliferation of cutaneous squamous cell carcinoma through targeting miR-127-5p to regulate ADCY7. Cai L, Wang Y, Wu J, Wu G. Arch Dermatol Res. 2022 Aug;314(6):541-551.

  • Circular RNA circ_0128846 promotes the progression of osteoarthritis by regulating miR-127-5p/NAMPT axis. Liu C, Cheng P, Liang J, Zhao X, Du W. J Orthop Surg Res. 2021 May 11;16(1):307.

  • Overexpression of hsa_circ_0094742 inhibits IL-1β-induced decline in CHON-001 cell viability by targeting microRNA-127-5p. Sun M, Yang J, Jiang D, Bao G. Histol Histopathol. 2021 Feb;36(2):207-216.

    • There are 77 references associated with hsa-miR-127-5p. Click here to see the complete list in PubMed.