Mature miRNA: hsa-miR-125a-5p

Mature miRNA

miRNA Name hsa-miR-125a-5p
Previous Name hsa-miR-125a
miRNA Sequence 5' - ucccugagacccuuuaaccuguga - 3' (length = 24)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000443
Similar miRNAs hsa-miR-125b-5p, hsa-miR-4319 (sharing the same seed sequence with hsa-miR-125a-5p).

Precursor miRNA

Precursor Name hsa-mir-125a
Genomic Location chr19:51693254-51693339 (+); nearby genomic features
Clustered miRNAs hsa-mir-99b,hsa-let-7e,hsa-mir-125a (within 10kb in genome)
NCBI GENE ID 406910
MIM ID 611191
miRBase ID MI0000469
Precursor Sequence 
u     u u     uc  ug   c    ua        ----  a
 gccag c cuagg  cc  aga ccuu  accuguga    gg c
 ||||| | |||||  ||  ||| ||||  ||||||||    || 
 cgguc g ggucc  gg  ucu ggag  uggacacu    cc a
c     u c     ga  gu   u    --        ggga  u

References

  • Generation of Myeloid-Derived Suppressor Cells Mediated by MicroRNA-125a-5p in Melanoma. Lasser S, Ozbay Kurt FG, Fritz L, Gutzeit N, De La Torre C, Altevogt P, Utikal J, Umansky V. Int J Mol Sci. 2024 Jun 18;25(12):6693.

  • Exosome microRNA-125a-5p derived from epithelium promotes M1 macrophage polarization by targeting IL1RN in chronic obstructive pulmonary disease. Wang R, Zhu Z, Peng S, Xu J, Chen Y, Wei S, Liu X. Int Immunopharmacol. 2024 Aug 20;137:112466.

  • Identification of miR-125a and miR-106b signature as a potential diagnostic biomarker in breast cancer tissues. Ghafouri-Fard S, Hussen BM, Eslami S. Pathol Res Pract. 2024 Apr;256:155277.

  • Dual regulation of NEMO by Nrf2 and miR-125a inhibits ferroptosis and protects liver from endoplasmic reticulum stress-induced injury. Tak J, Joo MS, Kim YS, Park HW, Lee CH, Park GC, Hwang S, Kim SG. Theranostics. 2024 Feb 24;14(5):1841-1859.

  • Circulating levels of miR125a, miR126, and miR146a-5p in patients with obstructive sleep apnea and their relation with markers of endothelial dysfunction. Fadaei R, Fallah S, Moradi MT, Rostampour M, Khazaie H. PLoS One. 2023 Nov 2;18(11):e0287594.

  • An Investigation of the Effects of Jin YC, Dong LJ, Yang QY, Xiong WN, Wang WY, Feng XH, Yu W, Huang W, Chen BF. Biomed Environ Sci. 2023 Sep 20;36(9):814-825.

  • Long Noncoding RNA MIR600HG Binds to MicroRNA-125a-5p to Prevent Pancreatic Cancer Progression Via Mitochondrial Tumor Suppressor 1-Dependent Suppression of Extracellular Regulated Protein Kinases Signaling Pathway. Chen F, Zheng X, Liang W, Jiang C, Su D, Fu B. Pancreas. 2022 Nov-Dec 01;51(10):1434-1443.

  • Sequence-sensitive elastic network captures dynamical features necessary for miR-125a maturation. Mailhot O, Frappier V, Major F, Najmanovich RJ. PLoS Comput Biol. 2022 Dec 14;18(12):e1010777.

  • CircZXDC Promotes Vascular Smooth Muscle Cell Transdifferentiation via Regulating miRNA-125a-3p/ABCC6 in Moyamoya Disease. Liu Y, Huang Y, Zhang X, Ma X, He X, Gan C, Zou X, Wang S, Shu K, Lei T, Zhang H. Cells. 2022 Nov 26;11(23):3792.

  • AP2a-Mediated Upregulation of miR-125a-5p Ameliorates Radiation-Induced Oxidative Stress Injury via BRD4/Nrf2/HO-1 Signaling. Qiu J, Fang Y, Xiao S, Zeng F. Radiat Res. 2023 Feb 1;199(2):148-160.

  • Hsa_circ_0012919 promotes pyroptosis in CD4+T cells of systemic lupus erythematous by miR-125a-3p/GSDMD axis. Zhang C, Zhang C, Huang C, Ji J, Liu J, Lu Y. Exp Dermatol. 2023 Jan;32(1):41-49.

  • A Functional Network Driven by MicroRNA-125a Regulates Monocyte Trafficking in Acute Inflammation. Tomasi S, Li L, Hinske LC, Tomasi R, Amini M, Strauß G, Müller MB, Hirschberger S, Peterss S, Effinger D, Pogoda K, Kreth S, Hübner M. Int J Mol Sci. 2022 Sep 14;23(18):10684.

  • Downregulation of Shishavan NS, Sasani ST, Salehi Z, Azhang MR. Microrna. 2022;11(3):263-270.

  • miR-125a-3p aggravates ox-LDL-induced HUVEC injury through BAMBI. Xia F, Zeng Q. J Biochem Mol Toxicol. 2022 Nov;36(11):e23198.

  • Combination of Circulating miR-125a-5p, miR-223-3p and D-dimer as a Novel Biomarker for Deep Vein Thrombosis. Xu L, Ji C, Miao X, Ge J, Li F, Xu C. Am J Med Sci. 2022 Nov;364(5):601-611.

  • Methylation-mediated silencing of miR-125a-5p facilitates breast cancer progression by inducing autophagy. Ahmadpour F, Igder S, Babaahmadi-Rezaei H, Khalili E, Kanani M, Soleimani V, Mohammadzadeh G. Mol Biol Rep. 2022 Jul;49(7):6325-6339.

  • Long non-coding RNA MIR4435-2HG/microRNA-125a-5p axis is involved in myocardial ischemic injuries. Wang X, Ren L, Chen S, Tao Y, Zhao D, Wu C. Bioengineered. 2022 Apr;13(4):10707-10720.

  • Cell-Crossing Functional Network Driven by microRNA-125a Regulates Endothelial Permeability and Monocyte Trafficking in Acute Inflammation. Müller MB, Hübner M, Li L, Tomasi S, Ließke V, Effinger D, Hirschberger S, Pogoda K, Sperandio M, Kreth S. Front Immunol. 2022 Mar 24;13:826047.

  • MicroRNA-125a/b-5p promotes malignant behavior in multiple myeloma cells and xenograft tumor growth by targeting DIS3. Zhang T, Wang LL, Guan J, Zhou Y, Cheng P, Zou L. Kaohsiung J Med Sci. 2022 Jun;38(6):574-584.

  • miR-125a attenuates the malignant biological behaviors of cervical squamous cell carcinoma cells through Rad51. Liu Z, Huang J, Jiang Q, Li X, Tang X, Chen S, Jiang L, Fu G, Liu S. Bioengineered. 2022 Apr;13(4):8503-8514.

    • There are 286 references associated with hsa-miR-125a-5p. Click here to see the complete list in PubMed.