Mature miRNA: hsa-miR-1247-3p



Mature miRNA

miRNA Name hsa-miR-1247-3p
miRNA Sequence 5' - ccccgggaacgucgagacuggagc - 3' (length = 24)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0022721

Precursor miRNA

Precursor Name hsa-mir-1247
Genomic Location chr14:101560287-101560422 (-); nearby genomic features
NCBI GENE ID 100302145
miRBase ID MI0006382
Precursor Sequence
c    u  -    ---c  a   c  cccc   -  --c       a  c   c  uu   c     ac  ugc
 cgcu gc cucg    cc gcg ag    ggc cg   ugggcgc cc guc cg  cgu cccgg  gu   u
 |||| || ||||    || ||| ||    ||| ||   ||||||| || ||| ||  ||| |||||  ||   
 gcgg cg gagc    gg cgc uc    ccg gu   gcccgcg gg cag gc  gca gggcc  ca   c
-    -  a    ccca  -   u  --ca   a  caa       a  u   a  -u   a     -c  ucu

References


  • Tumor-derived exosomal miR-1247-3p promotes angiogenesis in bladder cancer by targeting FOXO1. Liu Z, Du D, Zhang S. Cancer Biol Ther. 2024 Dec 31;25(1):2290033.

  • Crucial role of hsa-mir-503, hsa-mir-1247, and their validation in prostate cancer. Hu P, Wang T, Yan H, Huang Y, Zhao Y, Gao Y. Aging (Albany NY). 2023 Nov 16;15(22):12966-12981.

  • Characterization of Adrenal miRNA-Based Dysregulations in Cushing's Syndrome. Vetrivel S, Zhang R, Engel M, Oßwald A, Watts D, Chen A, Wielockx B, Sbiera S, Reincke M, Riester A. Int J Mol Sci. 2022 Jul 12;23(14):7676.

  • MiR-1247-5p Functions as a Tumor Suppressor in Human Astroglioma Cells by Targeting Liu Q, Dong Z, Chen T. Ann Clin Lab Sci. 2020 Mar;50(2):182-189.

  • The Potential Role of Selected miRNA in Uveal Melanoma Primary Tumors as Early Biomarkers of Disease Progression. Wróblewska JP, Lach MS, Ustaszewski A, Kulcenty K, Ibbs M, Jagiełło I, Suchorska WM, MarszaÅ‚ek A. Genes (Basel). 2020 Mar 2;11(3):271.

  • MicroRNA-1247 inhibits the viability and metastasis of osteosarcoma cells via targeting NRP1 and mediating Wnt/β-catenin pathway. Wei QF, Yao JS, Yang YT. Eur Rev Med Pharmacol Sci. 2019 Sep;23(17):7266-7274.

  • Upregulated circular RNA circ_0070934 facilitates cutaneous squamous cell carcinoma cell growth and invasion by sponging miR-1238 and miR-1247-5p. An X, Liu X, Ma G, Li C. Biochem Biophys Res Commun. 2019 May 28;513(2):380-385.

  • Stromal-induced downregulation of miR-1247 promotes prostate cancer malignancy. Taddei ML, Cavallini L, Ramazzotti M, Comito G, Pietrovito L, Morandi A, Giannoni E, Raugei G, Chiarugi P. J Cell Physiol. 2019 Jun;234(6):8274-8285.

  • Epigenetically regulated miR-1247 functions as a novel tumour suppressor via MYCBP2 in methylator colon cancers. Liang J, Zhou W, Sakre N, DeVecchio J, Ferrandon S, Ting AH, Bao S, Bissett I, Church J, Kalady MF. Br J Cancer. 2018 Nov;119(10):1267-1277.

  • Circular RNA circUBXN7 represses cell growth and invasion by sponging miR-1247-3p to enhance B4GALT3 expression in bladder cancer. Liu H, Chen D, Bi J, Han J, Yang M, Dong W, Lin T, Huang J. Aging (Albany NY). 2018 Oct 12;10(10):2606-2623.

  • Downregulated miR-1247-5p associates with poor prognosis and facilitates tumor cell growth via DVL1/Wnt/β-catenin signaling in breast cancer. Zeng B, Li Y, Feng Y, Lu M, Yuan H, Yi Z, Wu Y, Xiang T, Li H, Ren G. Biochem Biophys Res Commun. 2018 Oct 20;505(1):302-308.

  • Association of miR-1247-5p expression with clinicopathological parameters and prognosis in breast cancer. Zhang P, Fan C, Du J, Mo X, Zhao Q. Int J Exp Pathol. 2018 Aug;99(4):199-205.

  • Inhibition of miR-1247 on cell proliferation and invasion in bladder cancer through its downstream target of RAB36. Zhu Y, Liang S, Pan H, Cheng Z, Rui X. J Biosci. 2018 Jun;43(2):365-373.

  • MicroRNA-1247 inhibits cell proliferation by directly targeting ZNF346 in childhood neuroblastoma. Wu T, Lin Y, Xie Z. Biol Res. 2018 May 24;51(1):13.

  • Tumor-derived exosomal miR-1247-3p induces cancer-associated fibroblast activation to foster lung metastasis of liver cancer. Fang T, Lv H, Lv G, Li T, Wang C, Han Q, Yu L, Su B, Guo L, Huang S, Cao D, Tang L, Tang S, Wu M, Yang W, Wang H. Nat Commun. 2018 Jan 15;9(1):191.

  • miR-1247-5p functions as a tumor suppressor in human hepatocellular carcinoma by targeting Wnt3. Chu Y, Fan W, Guo W, Zhang Y, Wang L, Guo L, Duan X, Wei J, Xu G. Oncol Rep. 2017 Jul;38(1):343-351.

  • Epigenetically altered miR-1247 functions as a tumor suppressor in pancreatic cancer. Yi JM, Kang EJ, Kwon HM, Bae JH, Kang K, Ahuja N, Yang K. Oncotarget. 2017 Apr 18;8(16):26600-26612.

  • MiRNA profile of osteosarcoma with CD117 and stro-1 expression: miR-1247 functions as an onco-miRNA by targeting MAP3K9. Zhao F, Lv J, Gan H, Li Y, Wang R, Zhang H, Wu Q, Chen Y. Int J Clin Exp Pathol. 2015 Feb 1;8(2):1451-8. eCollection 2015.

  • MiR-1247-5p is overexpressed in castration resistant prostate cancer and targets MYCBP2. Scaravilli M, Porkka KP, Brofeldt A, Annala M, Tammela TL, Jenster GW, Nykter M, Visakorpi T. Prostate. 2015 Jun;75(8):798-805.

  • Epigenetically regulated MIR941 and MIR1247 target gastric cancer cell growth and migration. Kim JG, Kim TO, Bae JH, Shim JW, Kang MJ, Yang K, Ting AH, Yi JM. Epigenetics. 2014 Jul;9(7):1018-30.


  • There are 24 references associated with hsa-miR-1247-3p. Click here to see the complete list in PubMed.