Mature miRNA: hsa-miR-1228-3p

Mature miRNA

miRNA Name hsa-miR-1228-3p
Previous Name hsa-miR-1228
miRNA Sequence 5' - ucacaccugccucgcccccc - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0005583

Precursor miRNA

Precursor Name hsa-mir-1228
Genomic Location chr12:57194504-57194576 (+); nearby genomic features
NCBI GENE ID 100302201
miRBase ID MI0006318
Precursor Sequence 
---gu        g        uggu    ggugg     g
     gggcgggg caggugug    gggu     ccugc g
     |||||||| ||||||||    ||||     |||||  u
     cccgcucc guccacac    cccg     ggacg g
gaccc        -        ---u    -----     a

References

  • Exosomal miR-1228-5p down-regulates DUSP22 to promotes cell proliferation and migration in small cell lung cancer. Mu X, Yu C, Zhao Y, Hu X, Wang H, He Y, Wu H. Life Sci. 2024 Aug 15;351:122787.

  • Extracellular vesicles derived from cancer-associated fibroblasts carry tumor-promotive microRNA-1228-3p to enhance the resistance of hepatocellular carcinoma cells to sorafenib. Zhang Y, Pan Q, Shao Z. Hum Cell. 2023 Jan;36(1):296-311.

  • Ultrasound-Targeted Microbubble Destruction-Mediated miR-1228 Downregulation Suppresses Tumor Proliferation, Migration, and Invasion of Cervical-Cancer Cells. Bu Y, Li Q, Liang X, Gao Q, Ma X, Jin M, Yang X. Gynecol Obstet Invest. 2022;87(3-4):211-218.

  • MicroRNA 1228 Mediates the Viability of High Glucose-Cultured Renal Tubule Cells through Targeting Thrombospondin 2 and PI3K/AKT Signaling Pathway. Mo T, Fu Q, Hu X, Fu Y, Li J. Kidney Blood Press Res. 2022;47(1):1-12.

  • CircGFRA1 facilitates the malignant progression of HER-2-positive breast cancer via acting as a sponge of miR-1228 and enhancing AIFM2 expression. Bazhabayi M, Qiu X, Li X, Yang A, Wen W, Zhang X, Xiao X, He R, Liu P. J Cell Mol Med. 2021 Nov;25(21):10248-10256.

  • Plasma-Derived Exosomal hsa-miR-4488 and hsa-miR-1228-5p: Novel Biomarkers for Dermatomyositis-Associated Interstitial Lung Disease with Anti-Melanoma Differentiation-Associated Protein 5 Antibody-Positive Subset. Zhong D, Wu C, Xu D, Bai J, Wang Q, Zeng X. Biomed Res Int. 2021 Jul 28;2021:6676107.

  • CircRAB3B suppresses proliferation, motility, cell cycle progression and promotes the apoptosis of IL-22-induced keratinocytes depending on the regulation of miR-1228-3p/PTEN axis in psoriasis. Lu J, Xu X, Li Y, Yu N, Ding Y, Shi Y. Autoimmunity. 2021 Aug;54(5):303-312.

  • Hsa_circ_0000301 facilitates the progression of cervical cancer by targeting miR-1228-3p/IRF4 Axis. Deng ZM, Dai FF, Zhou Q, Cheng YX. BMC Cancer. 2021 May 21;21(1):583.

  • Exosomes derived from miR-1228 overexpressing bone marrow-mesenchymal stem cells promote growth of gastric cancer cells. Chang L, Gao H, Wang L, Wang N, Zhang S, Zhou X, Yang H. Aging (Albany NY). 2021 Apr 21;13(8):11808-11821.

  • Circ_0004417 inhibits the progression of prostate cancer through sponging miR-1228. Xia HY, Liu CD, Liang W, Huo XY, Wei XW. Eur Rev Med Pharmacol Sci. 2021 Feb;25(3):1274-1281.

  • Circulating microRNA-194 and microRNA-1228 Could Predict Colon Cancer Proliferation via Phospho S6 Modulation. Pasca S, Ionescu C, Andras D, Eniu D, Muresan MA, Magdo L, Jurj A, Raduly L, Cojocneanu R, Petrushev B, Zaharie F, Irimie A, Berindan-Neagoe I, Muresan MS. J Gastrointestin Liver Dis. 2020 Sep 9;29(3):361-367.

  • Serum miR-1228-3p and miR-181a-5p as Noninvasive Biomarkers for Non-Small Cell Lung Cancer Diagnosis and Prognosis. Xue WX, Zhang MY, Rui Li, Liu X, Yin YH, Qu YQ. Biomed Res Int. 2020 Jul 6;2020:9601876.

  • Urinary miRNA-27b-3p and miRNA-1228-3p correlate with the progression of Kidney Fibrosis in Diabetic Nephropathy. Conserva F, Barozzino M, Pesce F, Divella C, Oranger A, Papale M, Sallustio F, Simone S, Laviola L, Giorgino F, Gallone A, Pontrelli P, Gesualdo L. Sci Rep. 2019 Aug 6;9(1):11357.

  • Exosomal miR-1228 From Cancer-Associated Fibroblasts Promotes Cell Migration and Invasion of Osteosarcoma by Directly Targeting SCAI. Wang JW, Wu XF, Gu XJ, Jiang XH. Oncol Res. 2019 Sep 23;27(9):979-986.

  • CircRNA hsa_circ_100395 regulates miR-1228/TCF21 pathway to inhibit lung cancer progression. Chen D, Ma W, Ke Z, Xie F. Cell Cycle. 2018;17(16):2080-2090.

  • microRNA-1228 Jia L, Chen J, Xie C, Shao L, Xu Z, Zhang L. Life Sci. 2017 Jul 1;180:9-16.

  • MicroRNA-1228(*) inhibit apoptosis in A549 cells exposed to fine particulate matter. Li X, Ding Z, Zhang C, Zhang X, Meng Q, Wu S, Wang S, Yin L, Pu Y, Chen R. Environ Sci Pollut Res Int. 2016 May;23(10):10103-13.

  • MiR-1228 promotes breast cancer cell growth and metastasis through targeting SCAI protein. Lin L, Liu D, Liang H, Xue L, Su C, Liu M. Int J Clin Exp Pathol. 2015 Jun 1;8(6):6646-55. eCollection 2015.

  • miR-1228 promotes the proliferation and metastasis of hepatoma cells through a p53 forward feedback loop. Zhang Y, Dai J, Deng H, Wan H, Liu M, Wang J, Li S, Li X, Tang H. Br J Cancer. 2015 Jan 20;112(2):365-74.

  • Human miR-1228 as a stable endogenous control for the quantification of circulating microRNAs in cancer patients. Hu J, Wang Z, Liao BY, Yu L, Gao X, Lu S, Wang S, Dai Z, Zhang X, Chen Q, Qiu SJ, Wu Y, Zhu H, Fan J, Zhou J, Wang J. Int J Cancer. 2014 Sep 1;135(5):1187-94.

    • There are 26 references associated with hsa-miR-1228-3p. Click here to see the complete list in PubMed.