Mature miRNA: hsa-miR-122-5p

Mature miRNA

miRNA Name hsa-miR-122-5p
Previous Name hsa-miR-122a;hsa-miR-122
miRNA Sequence 5' - uggagugugacaaugguguuug - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000421

Precursor miRNA

Precursor Name hsa-mir-122
Genomic Location chr18:58451074-58451158 (+); nearby genomic features
Clustered miRNAs hsa-mir-122,hsa-mir-122b (within 10kb in genome)
NCBI GENE ID 406906
MIM ID 609582
miRBase ID MI0000442
Precursor Sequence 
c        -      gg       c           --u  c
 cuuagcag agcugu  aguguga aaugguguuug   gu u
 |||||||| ||||||  ||||||| |||||||||||   || 
 ggaucguc ucgaua  ucacacu uuaccgcaaac   ca a
c        a      aa       a           uau  a

References

  • Dysregulated expression of miR-140 and miR-122 compromised microglial chemotaxis and led to reduced restriction of AD pathology. Song C, Li S, Mai Y, Li L, Dai G, Zhou Y, Liang X, Zou OM, Wang Y, Zhou L, Liu J, Zou Y. J Neuroinflammation. 2024 Jul 2;21(1):167.

  • Dysregulation of miR-122, miR-574 and miR-375 in Egyptian patients with breast cancer. Elghoroury EA, Abdelghafar EE, Kamel S, Awadallah E, Shalaby A, El-Saeed GSM, Mahmoud E, Kamel MM, Abobakr A, Yousef RN. PLoS One. 2024 May 31;19(5):e0298536.

  • CircPHGDH downregulation decreases papillary thyroid cancer progression through miR-122-5p/PKM2 axis. Shen J, Ma Z, Yang J, Qu T, Xia Y, Xu Y, Zhou M, Liu W. BMC Cancer. 2024 Apr 23;24(1):511.

  • Ischemia and reperfusion-injured liver-derived exosomes elicit acute lung injury through miR-122-5p regulated alveolar macrophage polarization. Lyu J, Sheng M, Cao Y, Jia L, Zhang C, Weng Y, Yu W. Int Immunopharmacol. 2024 Apr 20;131:111853.

  • Exosomal miR-122-3p represses the growth and metastasis of MCF-7/ADR cells by targeting GRK4-mediated activation of the Wnt/β-catenin pathway. Song B, Hou G, Xu M, Chen M. Cell Signal. 2024 May;117:111101.

  • Circular RNA cVIM promotes hepatic stellate cell activation in liver fibrosis via miR-122-5p/miR-9-5p-mediated TGF-β signaling cascade. Zhou Z, Zhang R, Li X, Zhang W, Zhan Y, Lang Z, Tao Q, Yu J, Yu S, Yu Z, Zheng J. Commun Biol. 2024 Jan 19;7(1):113.

  • MicroRNA-29a and microRNA-122 expressions and other inflammatory markers among obese children with diabetes. Bayoumy NMK, El-Shabrawi MM, Elsayed W, Kamal HA, Abdelmaogood AK, Ahmed-Maher S, Omar HH, Abdel-Rahman A. J Pediatr Endocrinol Metab. 2023 Nov 16;37(1):21-26.

  • Binding of microRNA-122 to the hepatitis C virus 5' untranslated region modifies interactions with poly(C) binding protein 2 and the NS5B viral polymerase. Scott S, Li Y, Bermek O, Griffith JD, Lemon SM, Choi KH. Nucleic Acids Res. 2023 Dec 11;51(22):12397-12413.

  • miR-122 and miR-21 are Stable Components of miRNA Signatures of Early Lung Cancer after Validation in Three Independent Cohorts. Zyla J, Dziadziuszko R, Marczyk M, Sitkiewicz M, Szczepanowska M, Bottoni E, Veronesi G, Rzyman W, Polanska J, Widlak P. J Mol Diagn. 2024 Jan;26(1):37-48.

  • miR-122-5p Restrains Pancreatic Cancer Cell Growth and Causes Apoptosis by Negatively Regulating ASCT2. Ren P, Wu NA, Fu S, Wang W, Li QI, Cheng Q. Anticancer Res. 2023 Oct;43(10):4379-4388.

  • miR-122-5p is involved in posttranscriptional regulation of the mitochondrial thiamin pyrophosphate transporter ( Ramamoorthy K, Sabui S, Manzon KI, Balamurugan AN, Said HM. Am J Physiol Gastrointest Liver Physiol. 2023 Oct 1;325(4):G347-G355.

  • The role and mechanism of action of microRNA-122 in cancer: Focusing on the liver. Al-Gazally ME, Khan R, Imran M, Ramírez-Coronel AA, Alshahrani SH, Altalbawy FMA, Turki Jalil A, Romero-Parra RM, Zabibah RS, Shahid Iqbal M, Karampoor S, Mirzaei R. Int Immunopharmacol. 2023 Oct;123:110713.

  • Abnormal expression of miRNA-122 in cerebral infarction and related mechanism of regulating vascular endothelial cell proliferation and apoptosis by targeting CCNG1. Yu XJ, Zhang T, Wei ZZ, Gu B, Guo T, Jiang WJ, Shen YQ, Wang D, Wang Q, Wang J. Clinics (Sao Paulo). 2023 Apr 27;78:100199.

  • Hepatocyte-derived extracellular vesicles miR-122-5p promotes hepatic ischemia reperfusion injury by regulating Kupffer cell polarization. Liu L, Xiao F, Sun J, Wang Q, Wang A, Zhang F, Li Z, Wang X, Fang Z, Qiao Y. Int Immunopharmacol. 2023 Jun;119:110060.

  • miR-122 dysregulation is associated with type 2 diabetes mellitus-induced dyslipidemia and hyperglycemia independently of its rs17669 variant. Mokhtari Ardekani A, Mohammadzadehsaliani S, Behrouj H, Moridi H, Moradi MN, Ghasemi H. Mol Biol Rep. 2023 May;50(5):4217-4224.

  • Elucidating the distinct contributions of miR-122 in the HCV life cycle reveals insights into virion assembly. Rheault M, Cousineau SE, Fox DR, Abram QH, Sagan SM. Nucleic Acids Res. 2023 Mar 21;51(5):2447-2463.

  • Patients with abdominal aortic aneurysms have reduced levels of microRNA 122-5p in circulating exosomes. Lopez JL, Ramirez JL, Phu TA, Duong P, Bouchareychas L, Kuhrau CR, Lin PY, Eckalbar WL, Barczak AJ, Rudolph JD, Maliskova L, Conte MS, Vartanian SM, Raffai RL, Oskowitz AZ. PLoS One. 2023 Feb 14;18(2):e0281371.

  • Transcriptomic profiles-based approach to decode the role of miR-122 in triple negative breast cancer. Flores Fortis M, Perez Añorve IX, Del Moral Hernandez O, Villegas N, Arechaga Ocampo E. Genes Chromosomes Cancer. 2023 Jul;62(7):392-404.

  • LncRNA RPPH1 acts as a molecular sponge for miR-122 to regulate Wnt1/β-catenin signaling in hepatocellular carcinoma. Zhou J, Shi K, Huang W, Zhang Y, Chen Q, Mou T, Wu Z, Wei X. Int J Med Sci. 2023 Jan 1;20(1):23-34.

  • Interplay between TGF-b1 and miRNA-122 biomarkers in hepatocellular carcinoma progression in patients with chronic hepatitis C. Hamad RS, Al Abdulsalam NK, Elrefaiy MA, El-Araby RE. Trop Biomed. 2022 Dec 1;39(4):559-568.

    • There are 436 references associated with hsa-miR-122-5p. Click here to see the complete list in PubMed.