Mature miRNA: hsa-miR-107

Mature miRNA

miRNA Name hsa-miR-107
miRNA Sequence 5' - agcagcauuguacagggcuauca - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
Targeted Pathways miRDB
Expression Profile Display table
miRBase ID MIMAT0000104
Similar miRNAs hsa-miR-103a-3p (sharing the same seed sequence with hsa-miR-107).

Precursor miRNA

Precursor Name hsa-mir-107
Genomic Location chr10:89592747-89592827 (-); nearby genomic features
NCBI GENE ID 406901
MIM ID 613189
miRBase ID MI0000114
Precursor Sequence 
c   c      --c    u  u           c   u   a
 ucu ugcuuu   agcu cu uacaguguugc uug ggc u
 ||| ||||||   |||| || ||||||||||| ||| |||  g
 aga acgaaa   ucgg ga auguuacgacg aac uug g
-   c      cua    -  c           -   -   a

References

  • miR-107 reverses the multidrug resistance of gastric cancer by targeting the CGA/EGFR/GATA2 positive feedback circuit. Wang P, Zhou Y, Wang J, Zhou Y, Zhang X, Liu Y, Li A, He Y, Chen S, Qian A, Wang X, Nie Y, Fan D, Cao T, Lu Y, Zhao X. J Biol Chem. 2024 Aug;300(8):107522.

  • miR-107 Targets NSG1 to Regulate Hypopharyngeal Squamous Cell Carcinoma Progression through ERK Pathway. Hu Y, He Z, Han B, Lin Z, Zhou P, Li S, Huang S, Chen X. Int J Mol Sci. 2024 May 29;25(11):5961.

  • miR-107 and miR-126 and Risk of Breast Cancer: A Case-Control Study. Gupta P, Sambyal V, Bali JS, Guleria K, Uppal MS, Sudan M. Genet Test Mol Biomarkers. 2024 Apr;28(4):165-168.

  • Molecular insights into gastric cancer: The impact of TGFBR2 and hsa-mir-107 revealed by microarray sequencing and bioinformatics. Jin Z, Huang Z, Wu C, Zhang F, Gao Y, Guo S, Tao X, Lu S, Zhang J, Huang J, Zhai Y, Shi R, Ye P, Wu J. Comput Biol Med. 2024 Apr;172:108221.

  • LINC00662 promotes melanoma progression by competitively binding miR-107 and activating the β-catenin signaling pathway. Luo M, Lei R, Zhao Q, Shen Y, He Z, Xu J. Int J Med Sci. 2024 Jan 1;21(2):265-276.

  • Long non-coding RNA H19 promotes proliferation in hepatocellular carcinoma cells via H19/miR-107/CDK6 axis. Nokkeaw A, Thamjamrassri P, Chantaravisoot N, Tangkijvanich P, Ariyachet C. Oncol Res. 2023 Sep 15;31(6):989-1005.

  • MiR-107-3p Knockdown Alleviates Endothelial Injury in Sepsis via Kallikrein-Related Peptidase 5. Lin Y, Ma L, Dan H, Chen G, Dai J, Xu L, Liu Y. J Surg Res. 2023 Dec;292:264-274.

  • Abnormal expression of long non-coding RNA FGD5-AS1 affects the development of ovarian cancer through regulating miR-107/RBBP6 axis. Zhang W, Shi J, Liu G. Chin J Physiol. 2023 May-Jun;66(3):171-180.

  • MiR-107 Activates NF- κ B versus A β Analysis of the regulatory effect of 1-42 induced apoptosis in Alzheimer's disease cells. Peng Y, Du Z, Duan J, Shao Y, Nie S. Cell Mol Biol (Noisy-le-grand). 2023 Mar 31;69(3):28-32.

  • Clinical significance of Notch pathway-associated microRNA-107 in pancreatic ductal adenocarcinoma. Rashid S, Rashid S, Das P, Singh N, Dash NR, Nayak B, Sati HC, Chauhan SS, Gupta S, Saraya A. Future Oncol. 2023 May;19(14):1003-1012.

  • Aberrant Expression of FGFRL1 in Esophageal Cancer and Its Regulation by miR-107. Sharma P, Kaushik V, Saraya A, Sharma R. Asian Pac J Cancer Prev. 2023 Apr 1;24(4):1331-1341.

  • Association of Vidic Z, Goricar K, Strazisar B, Besic N, Dolzan V. Radiol Oncol. 2023 Mar 22;57(1):111-120.

  • miR-196b-5p and miR-107 Expression Differentiates Ocular Sebaceous Carcinoma from Squamous Cell Carcinoma of the Conjunctiva. de Keizer ROB, Vriends ALM, Hötte GJ, Paridaens DA, Wiemer EAC, Verdijk RM. Int J Mol Sci. 2022 Apr 28;23(9):4877.

  • miR-107 is involved in the regulation of NEDD9-mediated invasion and metastasis in breast cancer. Zhou J, Sun X, Zhang X, Yang H, Jiang Z, Luo Q, Liu Y, Wang G. BMC Cancer. 2022 May 12;22(1):533.

  • Clinical Role of Serum miR107 in Type 2 Diabetes and Related Risk Factors. Å imonienÄ— D, Stukas D, DaukÅ¡a A, VeličkienÄ— D. Biomolecules. 2022 Apr 8;12(4):558.

  • Overexpression of microRNA-107 suppressed proliferation, migration, invasion, and the PI3K/Akt signaling pathway and induced apoptosis by targeting Nin one binding (NOB1) protein in a hypopharyngeal squamous cell carcinoma cell line (FaDu). Gao X, Fan X, Zeng W, Liang J, Guo N, Yang X, Zhao Y. Bioengineered. 2022 Mar;13(3):7881-7893.

  • LINC-DUBR Suppresses Malignant Progression of Ovarian Cancer by Downregulating miR-107 to Induce SMAC Expression. Han Z, Li D, Yang Y, Zhang H. J Healthc Eng. 2022 Mar 3;2022:4535655.

  • Circ-LTBP1 is involved in doxorubicin-induced intracellular toxicity in cardiomyocytes via miR-107/ADCY1 signal. Li C, Zhang L, Bu X, Wang J, Li L, Yang Z. Mol Cell Biochem. 2022 Apr;477(4):1127-1138.

  • Silencing long non-coding RNA LINC00960 inhibits osteosarcoma proliferation by sponging miR-107 to downregulate SALL4. Shi Y, Yang B, Zhao Y. Biochem Biophys Res Commun. 2022 Feb 12;592:99-105.

  • Exosomal microRNA-107 reverses chemotherapeutic drug resistance of gastric cancer cells through HMGA2/mTOR/P-gp pathway. Jiang L, Zhang Y, Guo L, Liu C, Wang P, Ren W. BMC Cancer. 2021 Dec 2;21(1):1290.

    • There are 164 references associated with hsa-miR-107. Click here to see the complete list in PubMed.