Rno-miR-21

From miRDB

Jump to: navigation, search

Mature miRNA

miRNA name rno-miR-21
miRNA sequence 5' - uagcuuaucagacugauguuga - 3' (length = 22)
Predicted targets miRDB; other predictions (TargetScan, PicTar, miRanda)
Validated targets TarBase
Evidence experimental; cloned [1-3]
Sanger accession MIMAT0000790
Similar miRNAs gga-miR-21, hsa-miR-21, hsa-miR-590-5p, mmu-miR-21, mmu-miR-590-5p (sharing the same seed sequence with rno-miR-21).

Precursor miRNA

Precursor name rno-mir-21
Genomic location chr10:74864500-74864591 (-); nearby genomic features
Clustered miRNAs rno-miR-21,rno-miR-21* (within 10kb in genome)
Sanger annotations MI0000850
Precursor sequence
u      ccu      gu        a     a     a    u a
 guacca   ugucgg  agcuuauc gacug uguug cugu g a
 ||||||   ||||||  |||||||| ||||| ||||| |||| |  u
 uauggu   acaguc  ucggguag cugac acaac ggua c c
c      uuu      ug        -     g     -    - u

References

1. Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).

rno-miR-21 Functions

This section is currently empty. Make your contribution today! Here is the Help Page for some basic editing skills. Click here to see an example page on miRNA functional annotations.

Personal tools