Rno-miR-21
From miRDB
Mature miRNA
| miRNA name | rno-miR-21 |
| miRNA sequence | 5' - uagcuuaucagacugauguuga - 3' (length = 22) |
| Predicted targets | miRDB; other predictions (TargetScan, PicTar, miRanda) |
| Validated targets | TarBase |
| Evidence | experimental; cloned [1-3] |
| Sanger accession | MIMAT0000790 |
| Similar miRNAs | gga-miR-21, hsa-miR-21, hsa-miR-590-5p, mmu-miR-21, mmu-miR-590-5p (sharing the same seed sequence with rno-miR-21). |
Precursor miRNA
| Precursor name | rno-mir-21 |
| Genomic location | chr10:74864500-74864591 (-); nearby genomic features |
| Clustered miRNAs | rno-miR-21,rno-miR-21* (within 10kb in genome) |
| Sanger annotations | MI0000850 |
| Precursor sequence |
u ccu gu a a a u a guacca ugucgg agcuuauc gacug uguug cugu g a |||||| |||||| |||||||| ||||| ||||| |||| | u uauggu acaguc ucggguag cugac acaac ggua c c c uuu ug - g - - u |
References
| 1. | Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004). |
| 2. | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006). |
| 3. | A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007). |
rno-miR-21 Functions
This section is currently empty. Make your contribution today! Here is the Help Page for some basic editing skills. Click here to see an example page on miRNA functional annotations.
