Help:Example

From miRDB

Jump to: navigation, search

This is an example to show what a miRNA function page should look like.

Mature miRNA

miRNA name hsa-miR-21
miRNA sequence 5' - uagcuuaucagacugauguuga - 3' (length = 22)
Predicted targets miRDB; other predictions (TargetScan, PicTar, miRanda)
Validated targets TarBase
Targeted pathways miRDB
Expression profile Display table
Evidence experimental; cloned [1-3,6-9], Northern [1,5]
Sanger accession MIMAT0000076
Sanger comments Mourelatos et al. named this sequence miR-21 precursor-17 and also reported the exact reverse complement of this predicted stem-loop sequence and erroneously assigned the name miR-104 [2].
Similar miRNAs hsa-miR-590-5p, gga-miR-21, mmu-miR-21, mmu-miR-590-5p, rno-miR-21 (sharing the same seed sequence with hsa-miR-21).

Precursor miRNA

Precursor name hsa-mir-21
Genomic location chr17:55273409-55273480 (+); nearby genomic features
Clustered miRNAs hsa-miR-21,hsa-miR-21* (within 10kb in genome)
Sanger annotations MI0000077
Precursor sequence 
u     gu        a     a     a    u a
 gucgg  agcuuauc gacug uguug cugu g a
 |||||  |||||||| ||||| ||||| |||| |  u
 caguc  ucggguag cugac acaac ggua c c
a     ug        -     c     -    - u

References

1. Identification of novel genes coding for small expressed RNAs. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3. Reduced accumulation of specific microRNAs in colorectal neoplasia. Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4. Numerous microRNPs in neuronal cells containing novel microRNAs. Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
5. Human embryonic stem cells express a unique set of microRNAs. Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
6. Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
7. Identification of human fetal liver miRNAs by a novel method. Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
8. A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
9. Patterns of known and novel small RNAs in human cervical cancer. Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).

hsa-miR-21 Functions

hsa-miR-21 is overexpressed in most human cancers and it is widely believed to be an oncogene by downregulating the expression of many tumor suppressors. Many genes involved in cancer control are targeted by miR-21. Here are just a few examples:

  • Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells[1].
  • MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer [2].
  • MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer [3].
  • MicroRNA-21 targets the tumor suppressor gene tropomyosin 1 (TPM1) [4].
  • miR-21-mediated tumor growth [5].
  • MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells [6].


References

  1. ↑ Frankel LB, Christoffersen NR, Jacobsen A, Lindow M, Krogh A, Lund AH. Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2007 Nov 8. PubMed link: 17991735
  2. ↑ Asangani IA, Rasheed SA, Nikolova DA, Leupold JH, Colburn NH, Post S, Allgayer H. MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer. Oncogene. 2007 Oct 29. PubMed link: 17968323
  3. ↑ Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST, Patel T. MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology. 2007 Aug;133(2):647-58. PubMed link: 17681183
  4. ↑ Zhu S, Si ML, Wu H, Mo YY. MicroRNA-21 targets the tumor suppressor gene tropomyosin 1 (TPM1). J Biol Chem. 2007 May 11;282(19):14328-36. PubMed link: 17363372
  5. ↑ Si ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY. miR-21-mediated tumor growth. Oncogene. 2007 Apr 26;26(19):2799-803. PubMed link: 17072344
  6. ↑ Chan JA, Krichevsky AM, Kosik KS. MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. Cancer Res. 2005 Jul 15;65(14):6029-33 PubMed link: 16024602
Retrieved from "http://mirdb.org/wiki/index.php5?title=Help:Example"
Personal tools