Mature miRNA: hsa-miR-935

Mature miRNA

miRNA Name hsa-miR-935
miRNA Sequence 5' - ccaguuaccgcuuccgcuaccgc - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004978

Precursor miRNA

Precursor Name hsa-mir-935
Genomic Location chr19:53982307-53982397 (+); nearby genomic features
NCBI GENE ID 100126325
miRBase ID MI0005757
Precursor Sequence 
         gcg      a             ccc  c   caucc
ggcgggggc   ggcggc guggcgggagcgg   cu ggc     u
|||||||||   |||||| |||||||||||||   || |||     
ucgcccucg   ccgccg caucgccuucgcc   ga ccg     c
         ---      c             auu  c   ucugc

References

  • MiR-93-5p inhibits retinal neurons apoptosis by regulating PDCD4 in acute ocular hypertension model. Tan C, Shi W, Zhang Y, Liu C, Hu T, Chen D, Huang J. Life Sci Alliance. 2023 Jun 12;6(9):e202201732.

  • Overexpression of microRNA-93-5p and microRNA-374a-5p Suppresses the Osteogenic Differentiation and Mineralization of Human Aortic Valvular Interstitial Cells Through the BMP2/Smad1/5/RUNX2 Signaling Pathway. Liu C, Zhang Y, Guo J, Sun W, Ji Y, Wang Y, Liu J, Kong X. J Cardiovasc Pharmacol. 2023 Aug 1;82(2):138-147.

  • Exosomal miR-93-5p from cancer-associated fibroblasts confers malignant phenotypes on bladder cancer cells by targeting PAFAH1B1. Lu X, Wang J, Dong B, Wang L, Liu Y. Anticancer Drugs. 2023 Mar 1;34(3):439-450.

  • miR-935 Inhibits Oral Squamous Cell Carcinoma and Targets Inositol Polyphosphate-4-phosphatase Type IA (INPP4A). Maruyama N, Umikawa M, Matsumoto H, Maruyama T, Nishihara K, Nakasone T, Matayoshi A, Goto T, Hirano F, Arasaki A, Nakamura H, Matsuzaki G, Takaesu G. Anticancer Res. 2020 Nov;40(11):6101-6113.

  • MicroRNA-935 acts as a prognostic marker and promotes cell proliferation, migration, and invasion in colorectal cancer. Huang Y, Xiao W, Jiang X, Li H. Cancer Biomark. 2019;26(2):229-237.

  • IL-27 inhibits non-small-cell lung cancer cell metastasis by miR-935 in vitro. Wang T, Chen Y, Nie H, Huang Y, Zhao Y, Yang J. Onco Targets Ther. 2019 Feb 21;12:1447-1454.

  • INT-HA induces M2-like macrophage differentiation of human monocytes via TLR4-miR-935 pathway. Zhang B, Du Y, He Y, Liu Y, Zhang G, Yang C, Gao F. Cancer Immunol Immunother. 2019 Feb;68(2):189-200.

  • microRNA-935 is reduced in non-small cell lung cancer tissue, is linked to poor outcome, and acts on signal transduction mediator E2F7 and the AKT pathway. Wang C, Li S, Xu J, Niu W, Li S. Br J Biomed Sci. 2019 Jan;76(1):17-23.

  • Expression of microRNA-129-2-3p and microRNA-935 in plasma and brain tissue of human refractory epilepsy. Sun Y, Wang X, Wang Z, Zhang Y, Che N, Luo X, Tan Z, Sun X, Li X, Yang K, Wang G, Luan L, Liu Y, Zheng X, Wei M, Cheng H, Yin J. Epilepsy Res. 2016 Nov;127:276-283.

  • miR-935 Promotes Liver Cancer Cell Proliferation and Migration by Targeting SOX7. Liu X, Li J, Yu Z, Li J, Sun R, Kan Q. Oncol Res. 2017 Mar 13;25(3):427-435.

  • miR-935 promotes gastric cancer cell proliferation by targeting SOX7. Yang M, Cui G, Ding M, Yang W, Liu Y, Dai D, Chen L. Biomed Pharmacother. 2016 Apr;79:153-8.

  • miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression. Yan C, Yu J, Kang W, Liu Y, Ma Z, Zhou L. Biochem Biophys Res Commun. 2016 Jan 29;470(1):68-74.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Patterns of known and novel small RNAs in human cervical cancer. Lui WO, Pourmand N, Patterson BK, Fire A. Cancer Res. 2007 Jul 1;67(13):6031-43.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.