Mature miRNA: hsa-miR-6838-3p

Mature miRNA

miRNA Name hsa-miR-6838-3p
miRNA Sequence 5' - aaguccugcuucuguugcag - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0027579

Precursor miRNA

Precursor Name hsa-mir-6838
Genomic Location chr7:44073378-44073433 (-); nearby genomic features
NCBI GENE ID 102465504
miRBase ID MI0022684
Precursor Sequence 
cagggaa       u    a    -  uag
       gcagcag ggca gacu cc   g
       ||||||| |||| |||| ||   
       cguuguc ucgu cuga gg   u
-----ga       u    c    a  cac

References

  • [MiR-6838-5p overexpression inhibits proliferation of breast cancer MCF-7 cells by downregulating DDR1 expression]. Xue L, Tan Q, Xu J, Feng L, Li W, Yan L, Li Y. Nan Fang Yi Ke Da Xue Xue Bao. 2024 Sep 20;44(9):1677-1684.

  • LncRNA SH3BP5-AS1 promotes hepatocellular carcinoma progression by sponging miR-6838-5p and activation of PTPN4. Zhao X, Zhu X, Xiao C, Hu Z. Aging (Albany NY). 2024 May 16;16(10):8511-8523.

  • MYC-activated CERS6-AS1 sponges miR-6838-5p and regulates the expression of RUBCNL in colorectal cancer. Chen D, You H, Xu X, Liu D, Shen M, Pan Y, Liu Z, Zhang L, Wang H. Cell Mol Biol (Noisy-le-grand). 2022 Dec 31;68(12):42-48.

  • LncRNA CERS6-AS1, sponging miR-6838-5p, promotes proliferation and invasion in cervical carcinoma cells by upregulating FOXP2. Yan K, Hu C, Liu C, Chu G, Wang X, Ma S, Li L. Histol Histopathol. 2023 Jul;38(7):823-835.

  • MicroRNA-6838-5p suppresses the self-renewal and metastasis of human liver cancer stem cells through downregulating CBX4 expression and inactivating ERK signaling. Dou Z, Lu F, Hu J, Wang H, Li B, Li X. Biol Chem. 2022 Oct 11;404(1):29-39.

  • Hsa_circ_0008434 regulates USP9X expression by sponging miR-6838-5p to promote gastric cancer growth, migration and invasion. Xu X, Wang S, Wang H, Pan C, Yang W, Yu J. BMC Cancer. 2021 Dec 2;21(1):1289.

  • Long Noncoding RNA CERS6-AS1 Accelerates the Proliferation and Migration of Pancreatic Cancer Cells by Sequestering MicroRNA-15a-5p and MicroRNA-6838-5p and Modulating HMGA1. Shen R, Wang X, Wang S, Zhu D, Li M. Pancreas. 2021 Apr 1;50(4):617-624.

  • miR-6838-5p Affects Cell Growth, Migration, and Invasion by Targeting GPRIN3 via the Wnt/β-Catenin Signaling Pathway in Gastric Cancer. Zhou W, Ding X, Jin P, Li P. Pathobiology. 2020;87(6):327-337.

  • MiR-6838-5p suppresses cell metastasis and the EMT process in triple-negative breast cancer by targeting WNT3A to inhibit the Wnt pathway. Liu G, Wang P, Zhang H. J Gene Med. 2019 Dec;21(12):e3129.

  • Discovery of hundreds of mirtrons in mouse and human small RNA data. Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC. Genome Res. 2012 Sep;22(9):1634-45.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.