Mature miRNA: hsa-miR-6800-3p

Mature miRNA

miRNA Name hsa-miR-6800-3p
miRNA Sequence 5' - caccucuccuggcaucgcccc - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0027501

Precursor miRNA

Precursor Name hsa-mir-6800
Genomic Location chr19:49832018-49832099 (+); nearby genomic features
NCBI GENE ID 102465480
miRBase ID MI0022645
Precursor Sequence 
ac   ua     ca        cg        u    cu    c
  cug  gguga  gucagggg  gggugugg gggg  gggg u
  |||  |||||  ||||||||  |||||||| ||||  |||| 
  gac  ccgcu  cgguccuc  uccacacu ccuc  cccc g
--   cc     -a        --        -    --    g

References

  • Exosomal miR-146a-5p from Treponema pallidum-stimulated macrophages reduces endothelial cells permeability and monocyte transendothelial migration by targeting JAM-C. Hu W, Xu B, Zhang J, Kou C, Liu J, Wang Q, Zhang R. Exp Cell Res. 2020 Mar 1;388(1):111823.

  • ΔNp63α Suppresses TGFB2 Expression and RHOA Activity to Drive Cell Proliferation in Squamous Cell Carcinomas. Abraham CG, Ludwig MP, Andrysik Z, Pandey A, Joshi M, Galbraith MD, Sullivan KD, Espinosa JM. Cell Rep. 2018 Sep 18;24(12):3224-3236.

  • Discovery of hundreds of mirtrons in mouse and human small RNA data. Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC. Genome Res. 2012 Sep;22(9):1634-45.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.