Mature miRNA: hsa-miR-6780b-5p

Mature miRNA

miRNA Name hsa-miR-6780b-5p
miRNA Sequence 5' - uggggaaggcuuggcagggaaga - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0027572
Similar miRNAs hsa-miR-4271, hsa-miR-4725-3p (sharing the same seed sequence with hsa-miR-6780b-5p).

Precursor miRNA

Precursor Name hsa-mir-6780b
Genomic Location chr6:43434542-43434620 (+); nearby genomic features
NCBI GENE ID 102466746
miRBase ID MI0022681
Precursor Sequence 
cagc          cuu       a   ca a   gc    c
    cuggggaagg   ggcaggg aga  c uga  agug c
    ||||||||||   ||||||| |||  | |||  |||| 
    gaucccuuuc   cuguucc ucu  g acu  ucac u
----          -cu       c   cc c   --    c

References

  • Exosomes in ovarian cancer ascites promote epithelial-mesenchymal transition of ovarian cancer cells by delivery of miR-6780b-5p. Cai J, Gong L, Li G, Guo J, Yi X, Wang Z. Cell Death Dis. 2021 Feb 24;12(2):210.

  • Discovery of hundreds of mirtrons in mouse and human small RNA data. Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC. Genome Res. 2012 Sep;22(9):1634-45.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.