Mature miRNA: hsa-miR-601

Mature miRNA

miRNA Name hsa-miR-601
miRNA Sequence 5' - uggucuaggauuguuggaggag - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003269

Precursor miRNA

Precursor Name hsa-mir-601
Genomic Location chr9:123402525-123402603 (-); nearby genomic features
NCBI GENE ID 693186
miRBase ID MI0003614
Precursor Sequence 
ugcaugag   gu  --u  u  --      g    a  -   ca
        uuc  cu   gg cu  aggauu uugg gg agu  g
        |||  ||   || ||  |||||| |||| || |||   a
        agg  gg   cc ga  uccuag gacc cc uca  a
--------   ug  uuu  u  ag      g    -  a   aa

References

  • Identification of miR-106b-5p, miR-601, and miR-760 Expression and Their Clinical Values in Non-Small Cell Lung Cancer (NSCLC) Patients' Serum. El-Aal AEA, Elshafei A, Ismail MY, El-Shafey MM. Pathol Res Pract. 2023 Aug;248:154663.

  • MiR-601 Promotes Cell Proliferation of Human Glioblastoma Cells by Suppressing TINP1 Expression. Chen L, Zhu S, Wang H, Pang X, Wang X. Altern Ther Health Med. 2022 Feb;28(2):102-108.

  • Long noncoding RNA PP7080 promotes hepatocellular carcinoma development by sponging mir-601 and targeting SIRT1. Song W, Wenhui Z, Ruiqiang Y, Hu X, Shi T, Wang M, Zhang H. Bioengineered. 2021 Dec;12(1):1599-1610.

  • Increased expression of miR-601 is associated with poor prognosis and tumor progression of gastric cancer. Min C, Zhang A, Qin J. Diagn Pathol. 2019 Sep 23;14(1):107.

  • Targeting cullin 3 by miR-601 activates Nrf2 signaling to protect retinal pigment epithelium cells from hydrogen peroxide. Chen ZJ, Rong L, Huang D, Jiang Q. Biochem Biophys Res Commun. 2019 Aug 6;515(4):679-687.

  • MiR-601 inhibits the proliferation and metastasis of esophageal squamous cell carcinoma (ESCC) by targeting HDAC6. Liu C, Tian X, Sun HB, Wang ZF, Jiang LF, Li ZX. Eur Rev Med Pharmacol Sci. 2019 Feb;23(3):1069-1076.

  • Identification of miR-601 as a novel regulator in the development of pancreatic cancer. Cao W, Jin H, Zhang L, Chen X, Qian H. Biochem Biophys Res Commun. 2017 Jan 29;483(1):638-644.

  • miR-601 is a prognostic marker and suppresses cell growth and invasion by targeting PTP4A1 in breast cancer. Hu JY, Yi W, Wei X, Zhang MY, Xu R, Zeng LS, Huang ZJ, Chen JS. Biomed Pharmacother. 2016 Apr;79:247-53.

  • Plasma miR-601 and miR-760 are novel biomarkers for the early detection of colorectal cancer. Wang Q, Huang Z, Ni S, Xiao X, Xu Q, Wang L, Huang D, Tan C, Sheng W, Du X. PLoS One. 2012;7(9):e44398.

  • Profiling of molecular pathways regulated by microRNA 601. Ohdaira H, Nakagawa H, Yoshida K. Comput Biol Chem. 2009 Dec;33(6):429-33.

  • The colorectal microRNAome. Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE. Proc Natl Acad Sci U S A. 2006 Mar 7;103(10):3687-92.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.