Mature miRNA: hsa-miR-583



Mature miRNA

miRNA Name hsa-miR-583
miRNA Sequence 5' - caaagaggaaggucccauuac - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
Targeted Pathways miRDB
miRBase ID MIMAT0003248

Precursor miRNA

Precursor Name hsa-mir-583
Genomic Location chr5:96079138-96079212 (+); nearby genomic features
NCBI GENE ID 693168
miRBase ID MI0003590
Precursor Sequence
aacucacacauua          a        u      -   
             accaaagagg agguccca uacugc aggg
             |||||||||| |||||||| |||||| ||| a
             ugguuucucc uccagggu augacg uucu
-------------          a        c      a   

References


  • miR‑583 inhibits the proliferation and invasion of prostate cancer cells by targeting JAK1. Li Z, Chen J. Mol Med Rep. 2021 Mar;23(3):199.

  • The circular RNA FAM169A functions as a competitive endogenous RNA and regulates intervertebral disc degeneration by targeting miR-583 and BTRC. Guo W, Mu K, Zhang B, Sun C, Zhao L, Dong ZY, Cui Q. Cell Death Dis. 2020 May 4;11(5):315.

  • The colorectal microRNAome. Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE. Proc Natl Acad Sci U S A. 2006 Mar 7;103(10):3687-92.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.