Mature miRNA: hsa-miR-5590-5p

Mature miRNA

miRNA Name hsa-miR-5590-5p
miRNA Sequence 5' - uugccauacauagacuuuauu - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0022299

Precursor miRNA

Precursor Name hsa-mir-5590
Genomic Location chr2:134857820-134857873 (+); nearby genomic features
NCBI GENE ID 100847069
miRBase ID MI0019150
Precursor Sequence 
u          ag          guu
 ugccauacau  acuuuauugu   g
 ||||||||||  ||||||||||   
 acgguaugua  ugaaauaaca   a
a          cu          acu

References

  • MiR-5590-3p inhibits the proliferation and invasion of ovarian cancer cells through mediating the Wnt/β-catenin signaling pathway by targeting TNIK. Wu X, Zhong Y, Zhang H, Li M. Histol Histopathol. 2024 Mar;39(3):345-355.

  • LncRNA FGD5-AS1/miR-5590-3p axis facilitates the proliferation and metastasis of renal cell carcinoma through ERK/AKT signalling. Yang Y, Dong MH, Hu HM, Min QH, Xiao L. Eur Rev Med Pharmacol Sci. 2020 Sep;24(17):8756-8766.

  • Long noncoding RNA SNHG14 promotes malignancy of prostate cancer by regulating with miR-5590-3p/YY1 axis. Luo ZF, Peng Y, Liu FH, Ma JS, Hu G, Lai SL, Lin H, Chen JJ, Zou GM, Yan Q, Sui WG. Eur Rev Med Pharmacol Sci. 2020 May;24(9):4697-4709.

  • A SOX9-AS1/miR-5590-3p/SOX9 positive feedback loop drives tumor growth and metastasis in hepatocellular carcinoma through the Wnt/β-catenin pathway. Zhang W, Wu Y, Hou B, Wang Y, Deng D, Fu Z, Xu Z. Mol Oncol. 2019 Oct;13(10):2194-2210.

  • Regulatory effect of hsa-miR-5590-3P on TGFβ signaling through targeting of TGFβ-R1, TGFβ-R2, SMAD3 and SMAD4 transcripts. Abedini Bakhshmand E, Soltani BM. Biol Chem. 2019 Apr 24;400(5):677-685.

  • miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Friedländer MR, Mackowiak SD, Li N, Chen W, Rajewsky N. Nucleic Acids Res. 2012 Jan;40(1):37-52.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.