Mature miRNA: hsa-miR-552-3p

Mature miRNA

miRNA Name hsa-miR-552-3p
miRNA Sequence 5' - aacaggugacugguuagacaa - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003215

Precursor miRNA

Precursor Name hsa-mir-552
Genomic Location chr1:34669599-34669694 (-); nearby genomic features
NCBI GENE ID 693137
miRBase ID MI0003557
Precursor Sequence 
aaccauucaa                      uu ug        uu aa
          auauaccacaguuuguuuaacc  u  ccuguugg  g  g
          ||||||||||||||||||||||  |  ||||||||  |   a
          uauauggugucaaacagauugg  a  ggacaacu  c  u
-------aca                      uc gu        uu cg

References

  • Regulation of the PD-1/PD-L1 Axis and NK Cell Dysfunction by Exosomal miR-552-5p in Gastric Cancer. Tang CW, Yang JH, Qin JW, Wu HJ, Cui HP, Ge LY, Liu AQ. Dig Dis Sci. 2024 Sep;69(9):3276-3289.

  • miR-552 promotes the proliferation and metastasis of intrahepatic cholangiocarcinoma by targeting FOXO1. Cheng Z, Cheng N, Tang X, Yang F, Ma W, Yu Q, Tang H, Xiao Q, Lei Z. Exp Cell Res. 2023 Oct 1;431(1):113741.

  • MiR-552-3p Regulates Multiple Fibrotic and Inflammatory genes Concurrently in Hepatic Stellate Cells Improving NASH-associated Phenotypes. Ma N, Hou A, Pan X, Sun F, Xu X, Yu C, Lai R, Huang R, Gong L, Xie Q, Chen J, Ren J. Int J Biol Sci. 2023 Jul 3;19(11):3456-3471.

  • m Liu W, Zhang Z, Luo X, Qian K, Huang B, Liang J, Ma Z, Deng J, Yang C. Int J Oncol. 2023 Jul;63(1):81.

  • ZNF8-miR-552-5p Axis Modulates ACSL4-Mediated Ferroptosis in Hepatocellular Carcinoma. Yang H, Sun W, Bi T, Sun J, Lu Z, Li J, Wei H. DNA Cell Biol. 2023 Jun;42(6):336-347.

  • MiR-552-3p facilitated cell proliferation, migration and invasion by sponging Fibulin 5 in non-small cell lung cancer via activation of ERK/GSK3β/β-catenin signaling pathway. Huang M, Liao X, Li L, Li G, Chen M. Tissue Cell. 2021 Dec;73:101672.

  • FOXM1-induced miR-552 expression contributes to pancreatic cancer progression by targeting multiple tumor suppressor genes. Wang X, Dou N, Wang J, Zhang Y, Li Y, Gao Y. Int J Biol Sci. 2021 Mar 1;17(4):915-925.

  • Circular RNA SMARCA5 functions as an anti-tumor candidate in colon cancer by sponging microRNA-552. Yang S, Gao S, Liu T, Liu J, Zheng X, Li Z. Cell Cycle. 2021 Apr;20(7):689-701.

  • miR-552 promotes laryngocarcinoma cells proliferation and metastasis by targeting p53 pathway. Gu J, Han T, Sun L, Yan AH, Jiang XJ. Cell Cycle. 2020 May;19(9):1012-1021.

  • Linc00261 inhibits metastasis and the WNT signaling pathway of pancreatic cancer by regulating a miR‑552‑5p/FOXO3 axis. Chen T, Lei S, Zeng Z, Zhang J, Xue Y, Sun Y, Lan J, Xu S, Mao D, Guo B. Oncol Rep. 2020 Mar;43(3):930-942.

  • Upregulation of miR-552 Predicts Unfavorable Prognosis of Gastric Cancer and Promotes the Proliferation, Migration, and Invasion of Gastric Cancer Cells. Feng X, Zhu M, Liao B, Tian T, Li M, Wang Z, Chen G. Oncol Res Treat. 2020;43(3):103-111.

  • miR-552 promotes ovarian cancer progression by regulating PTEN pathway. Zhao W, Han T, Li B, Ma Q, Yang P, Li H. J Ovarian Res. 2019 Dec 9;12(1):121.

  • MicroRNA-552 promotes migration and invasion of osteosarcoma through targeting TIMP2. Chao Y, Hu K, Wang X, Wang L. Biochem Biophys Res Commun. 2019 Mar 26;511(1):63-68.

  • MiR-552 promotes the proliferation, migration and EMT of hepatocellular carcinoma cells by inhibiting AJAP1 expression. Qu W, Wen X, Su K, Gou W. J Cell Mol Med. 2019 Feb;23(2):1541-1552.

  • MicroRNA-552 promotes hepatocellular carcinoma progression by downregulating WIF1. Li C, Wang Z, Chen S, Zhang J, Qu K, Liu C. Int J Mol Med. 2018 Dec;42(6):3309-3317.

  • MicroRNA-552 links Wnt signaling to p53 tumor suppressor in colorectal cancer. Kwak B, Kim DU, Kim TO, Kim HS, Kim SW. Int J Oncol. 2018 Oct;53(4):1800-1808.

  • Genetic variants in microRNAs and their binding sites within gene 3'UTRs associate with susceptibility to age-related macular degeneration. Ghanbari M, Erkeland SJ, Xu L, Colijn JM, Franco OH, Dehghan A, Klaver CCW, Meester-Smoor MA. Hum Mutat. 2017 Jul;38(7):827-838.

  • MicroRNA-552 enhances metastatic capacity of colorectal cancer cells by targeting a disintegrin and metalloprotease 28. Wang J, Li H, Wang Y, Wang L, Yan X, Zhang D, Ma X, Du Y, Liu X, Yang Y. Oncotarget. 2016 Oct 25;7(43):70194-70210.

  • A dual inhibition: microRNA-552 suppresses both transcription and translation of cytochrome P450 2E1. Miao L, Yao H, Li C, Pu M, Yao X, Yang H, Qi X, Ren J, Wang Y. Biochim Biophys Acta. 2016 Apr;1859(4):650-62.

  • MiR-5000-3p, miR-5009-3P and miR-552: potential microRNA biomarkers of side population cells in colon cancer. Xia ZS, Wang L, Yu T, Zhong W, Lian GD, Wu D, Zhou HM, Chen GC. Oncol Rep. 2014 Aug;32(2):589-96.

    • There are 24 references associated with hsa-miR-552-3p. Click here to see the complete list in PubMed.