Mature miRNA: hsa-miR-551a

Mature miRNA

miRNA Name hsa-miR-551a
miRNA Sequence 5' - gcgacccacucuugguuucca - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003214
Similar miRNAs hsa-miR-551b-3p (sharing the same seed sequence with hsa-miR-551a).

Precursor miRNA

Precursor Name hsa-mir-551a
Genomic Location chr1:3560695-3560790 (-); nearby genomic features
NCBI GENE ID 693135
MIM ID 615148
miRBase ID MI0003556
Precursor Sequence 
ggggacug  -   ug            c         ggg   -  ucug
        cc ggg  acccuggaaauc agagugggu   gcc ag    a
        || |||  |||||||||||| |||||||||   ||| ||     c
        gg ccc  ugggaccuuugg ucucaccca   cgg uc    c
-----aaa  u   gu            u         --g   a  uuug

References

  • [Expression and clinical significance of microRNA-21-3p and microRNA-551-5p in patients with acute pancreatitis]. Wu K, Wang L, Fu G, Zheng Y. Zhonghua Wei Zhong Bing Ji Jiu Yi Xue. 2020 Apr;32(4):463-467.

  • Increased Expression of MicroRNA 551a by c-Fos Reduces Focal Adhesion Kinase Levels and Blocks Tumorigenesis. Anuj, Arivazhagan L, Venkatraman G, Rayala SK. Mol Cell Biol. 2019 Mar 19;39(7):e00577-18.

  • Extracellular metabolic energetics can promote cancer progression. Loo JM, Scherl A, Nguyen A, Man FY, Weinberg E, Zeng Z, Saltz L, Paty PB, Tavazoie SF. Cell. 2015 Jan 29;160(3):393-406.

  • miR-495 and miR-551a inhibit the migration and invasion of human gastric cancer cells by directly interacting with PRL-3. Li Z, Cao Y, Jie Z, Liu Y, Li Y, Li J, Zhu G, Liu Z, Tu Y, Peng G, Lee DW, Park SS. Cancer Lett. 2012 Oct 1;323(1):41-47.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • The colorectal microRNAome. Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE. Proc Natl Acad Sci U S A. 2006 Mar 7;103(10):3687-92.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.