Mature miRNA: hsa-miR-539-5p

Mature miRNA

miRNA Name hsa-miR-539-5p
Previous Name hsa-miR-539
miRNA Sequence 5' - ggagaaauuauccuuggugugu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003163

Precursor miRNA

Precursor Name hsa-mir-539
Genomic Location chr14:101047321-101047398 (+); nearby genomic features
Clustered miRNAs hsa-mir-376c,hsa-mir-376a-2,hsa-mir-654,hsa-mir-376b,hsa-mir-376a-1,hsa-mir-300,hsa-mir-1185-1,hsa-mir-1185-2,hsa-mir-381,hsa-mir-487b,hsa-mir-539,hsa-mir-889,hsa-mir-544a,hsa-mir-655,hsa-mir-487a,hsa-mir-382,hsa-mir-134,hsa-mir-668,hsa-mir-485,hsa-mir-323b (within 10kb in genome)
NCBI GENE ID 664612
miRBase ID MI0003514
Precursor Sequence 
     ug          a      g    -    - uuu
auacu  aggagaaauu uccuug ugug uucg c   a
|||||  |||||||||| |||||| |||| |||| |    u
uauga  uuuucuuuaa aggaac auac aagu g   u
     gu          c      -    u    a uau

References

  • miR-539-5p targets BMP2 to regulate Treg activation in B-cell acute lymphoblastic leukemia through TGF-β/Smads/MAPK. Dai Q, Shi R, Zhang G, Wang Y, Ye L, Peng L, Guo S, He J, Yang H, Jiang Y. Exp Biol Med (Maywood). 2024 Feb 13;249:10111.

  • LncRNA TP73-AS1 enhances the malignant properties of colorectal cancer by increasing SPP-1 expression through miRNA-539-5p sponging. Ding C, Zhang K, Chen Y, Hu H. Pathol Res Pract. 2023 Mar;243:154365.

  • Regulation of Iron-Ion Transporter SLC11A2 by Three Identical miRNAs. Sugino Y, Uchiyama R, Shibasaki C, Kugawa F. Biol Pharm Bull. 2022;45(9):1291-1299.

  • lncRNA LINC000466 Predicts the Prognosis and Promotes the Progression of Triple-negative Breast Cancer via Modulating miR-539-5p. Liu J, Yu H, Cui H, Wei F, Yan T, Li T, Liu Y, Chu J. Clin Breast Cancer. 2022 Jun;22(4):374-380.

  • miR-539 Targeting SNAI2 Regulates MMP9 Signaling Pathway and Affects Blood-Brain Barrier Permeability in Cerebrovascular Occlusive Diseases: A Study Based on Head and Neck Ultrasound and CTA. Li H, Han G, He D, Wang Y, Lin Y, Zhang T, Wang J, Du Y, Li G, Wang Y, Zhou J, Liu B. J Healthc Eng. 2021 Nov 27;2021:5699025.

  • Recombinant water stress protein 1 (Re-WSP1) suppresses colon cancer cell growth through the miR-539/β-catenin signaling pathway. Guo S, Shan S, Wu H, Hao H, Li Z. Mol Biol Rep. 2021 Nov;48(11):7059-7065.

  • Amniotic fluid microRNA profiles in twin-twin transfusion syndrome with and without severe recipient cardiomyopathy. Willner EC, Galan HL, Cuneo BF, Hoffman HA, Neltner B, Schuchardt EL, Karimpour-Fard A, Miyamoto SD, Sucharov CC. Am J Obstet Gynecol. 2021 Oct;225(4):439.e1-439.e10.

  • LncRNA PCGEM1 contributes to malignant behaviors of glioma by regulating miR-539-5p/CDK6 axis. Liu SL, Chen MH, Wang XB, You RK, An XW, Zhao Q, Wang RS. Aging (Albany NY). 2021 Feb 11;13(4):5475-5484.

  • Circ_0004104 Accelerates the Progression of Gastric Cancer by Regulating the miR-539-3p/RNF2 Axis. Yue F, Peng K, Zhang L, Zhang J. Dig Dis Sci. 2021 Dec;66(12):4290-4301.

  • LncRNA TP73-AS1/miR-539/MMP-8 axis modulates M2 macrophage polarization in hepatocellular carcinoma via TGF-β1 signaling. Chen J, Huang ZB, Liao CJ, Hu XW, Li SL, Qi M, Fan XG, Huang Y. Cell Signal. 2020 Nov;75:109738.

  • A SNP-mediated lncRNA (LOC146880) and microRNA (miR-539-5p) interaction and its potential impact on the NSCLC risk. Feng T, Feng N, Zhu T, Li Q, Zhang Q, Wang Y, Gao M, Zhou B, Yu H, Zheng M, Qian B. J Exp Clin Cancer Res. 2020 Aug 14;39(1):157.

  • LINC00460 promotes proliferation and inhibits apoptosis of non-small cell lung cancer cells through targeted regulation of miR-539. Wang HX, Kang LJ, Qin X, Xu J, Fei JW. Eur Rev Med Pharmacol Sci. 2020 Jun;24(12):6752-6758.

  • CASC21, a FOXP1 induced long non-coding RNA, promotes colorectal cancer growth by regulating CDK6. Gong T, Li Y, Feng L, Fang M, Dai G, Huang X, Yang Y, Liu S. Aging (Albany NY). 2020 Jun 25;12(12):12086-12106.

  • MiR-539-5p Decreases amyloid β-protein production, hyperphosphorylation of Tau and Memory Impairment by Regulating PI3K/Akt/GSK-3β Pathways in APP/PS1 Double Transgenic Mice. Jiang Y, Zhang Y, Su L. Neurotox Res. 2020 Aug;38(2):524-535.

  • lncRNA CRNDE promotes the proliferation and metastasis by acting as sponge miR-539-5p to regulate POU2F1 expression in HCC. Li Z, Wu G, Li J, Wang Y, Ju X, Jiang W. BMC Cancer. 2020 Apr 6;20(1):282.

  • miR‑539 suppresses the proliferation, migration, invasion and epithelial mesenchymal transition of pancreatic cancer cells through targeting SP1. Xue L, Shen Y, Zhai Z, Zheng S. Int J Mol Med. 2020 Jun;45(6):1771-1782.

  • LncRNA-ZNF281 Interacts with miR-539 to Promote Hepatocellular Carcinoma Cell Invasion and Migration. Zhang Z, Yang L, Yao X, Yang M, Li G. Cancer Biother Radiopharm. 2020 Mar;35(2):137-142.

  • LncRNA LUCAT1 contributes to cell proliferation and migration in human pancreatic ductal adenocarcinoma via sponging miR-539. Nai Y, Pan C, Hu X, Ma Y. Cancer Med. 2020 Jan;9(2):757-767.

  • MiR-539 inhibits the malignant behavior of breast cancer cells by targeting SP1. Cai F, Chen L, Sun Y, He C, Fu D, Tang J. Biochem Cell Biol. 2020 Jun;98(3):426-433.

  • Downregulation miR-539 is associated with poor prognosis of gastric cancer patients and aggressive progression of gastric cancer cells. Jin W, Han H, Liu D. Cancer Biomark. 2019;26(2):183-191.

    • There are 46 references associated with hsa-miR-539-5p. Click here to see the complete list in PubMed.