Mature miRNA: hsa-miR-524-5p

Mature miRNA

miRNA Name hsa-miR-524-5p
Previous Name hsa-miR-524*
miRNA Sequence 5' - cuacaaagggaagcacuuucuc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0002849
Similar miRNAs hsa-miR-520d-5p (sharing the same seed sequence with hsa-miR-524-5p).

Precursor miRNA

Precursor Name hsa-mir-524
Genomic Location chr19:53711002-53711088 (+); nearby genomic features
Clustered miRNAs hsa-mir-520b,hsa-mir-518b,hsa-mir-526a-1,hsa-mir-520c,hsa-mir-518c,hsa-mir-524,hsa-mir-517a,hsa-mir-519d,hsa-mir-521-2,hsa-mir-520d (within 10kb in genome)
NCBI GENE ID 574478
miRBase ID MI0003160
Precursor Sequence 
     u        c  a           a      cuug   
ucuca gcugugac cu caaagggaagc cuuucu    ucca
||||| |||||||| || ||||||||||| ||||||    ||| a
agagu uggcauug ga guuucccuucg ggaaga    agga
     u        u  g           c      --aa

References

  • Integrative Bioinformatics Analysis Reveals That miR-524-5p/MEF2C Regulates Bone Metastasis in Prostate Cancer and Breast Cancer. Tian Q, Lu Y, Yan B, Wu C. Comput Math Methods Med. 2022 Sep 10;2022:5211329.

  • Long non-coding RNA nuclear enriched abundant transcript 1 (NEAT1) modulates inhibitor of DNA binding 1 (ID1) to facilitate papillary thyroid carcinoma development by sponging microRNA-524-5p. Liao G, Huang Z, Gan T, Wu C, Wang X, Li D. Bioengineered. 2022 May;13(5):13201-13212.

  • YAP/miR-524-5p axis negatively regulates TXNIP expression to promote chondrosarcoma cell growth. Liu RX, Tang W, Zheng BY, Yang Y, Li ZY, Gui T, Zhang HT, Liu N, Zha ZG, Li JX. Biochem Biophys Res Commun. 2022 Jan 29;590:20-26.

  • Long noncoding RNA NEAT1 inhibits the acetylation of PTEN through the miR-524-5p /HDAC1 axis to promote the proliferation and invasion of laryngeal cancer cells. Zhang J, Wang P, Cui Y. Aging (Albany NY). 2021 Nov 27;13(22):24850-24865.

  • LINC00184 plays an oncogenic role in non-small cell lung cancer via regulation of the miR-524-5p/HMGB2 axis. Wang W, Li L, Zhao L. J Cell Mol Med. 2021 Nov;25(21):9927-9938.

  • Down-regulation of circITCH promotes osteosarcoma development and resistance to doxorubicin via the miR-524/RASSF6 axis. Zhou W, Liu Y, Wu X. J Gene Med. 2021 Oct;23(10):e3373.

  • Long non‑coding RNA SChLAP1 regulates the proliferation of triple negative breast cancer cells via the miR‑524‑5p/HMGA2 axis. Bai X, Zhang S, Qiao J, Xing X, Li W, Zhang H, Xie J. Mol Med Rep. 2021 Jun;23(6):446.

  • MicroRNA‑524‑5p regulates the proliferation and invasion of HTR‑8/SVneo trophoblasts by targeting NUMB in the Notch signaling pathway. Zheng L, Song J, Tang R, Chen X, Wang L, Wu D, Cen H, Shi L. Mol Med Rep. 2021 Jun;23(6):436.

  • MiR-524 suppressed the progression of oral squamous cell carcinoma by suppressing Metadherin and NF-κB signaling pathway in OSCC cell lines. Chang XS, Zhu J, Yang T, Gao Y. Arch Oral Biol. 2021 May;125:105090.

  • miR-524-5p reduces the progression of the BRAF inhibitor-resistant melanoma. Nguyen MT, Lin CH, Liu SM, Miyashita A, Ihn H, Lin H, Ng CH, Tsai JC, Chen MH, Tsai MS, Lin IY, Liu SC, Li LY, Fukushima S, Lu J, Ma N. Neoplasia. 2020 Dec;22(12):789-799.

  • microRNA-524-5p inhibits proliferation and induces cell cycle arrest of osteosarcoma cells via targeting CDK6. Chen H, Cheng C, Gao S. Biochem Biophys Res Commun. 2020 Sep 24;530(3):566-573.

  • MiR-524-5p Suppresses Migration, Invasion, and EMT Progression in Breast Cancer Cells Through Targeting Jin T, Zhang Y, Zhang T. Cancer Biother Radiopharm. 2020 Dec;35(10):789-801.

  • miR-524-5p inhibits angiogenesis through targeting WNK1 in colon cancer cells. Li X, Li Z, Zhu Y, Li Z, Yao L, Zhang L, Yuan L, Shang Y, Liu J, Li C. Am J Physiol Gastrointest Liver Physiol. 2020 Apr 1;318(4):G827-G839.

  • Downregulated miR-524-5p Participates in the Tumor Microenvironment of Ameloblastoma by Targeting the Interleukin-33 (IL-33)/Suppression of Tumorigenicity 2 (ST2) Axis. Chen L, Wang G, Qiao X, Wang X, Liu J, Niu X, Zhong M. Med Sci Monit. 2020 Jan 28;26:e921863.

  • MicroRNA-524-5p suppresses cell proliferation and promotes cell apoptosis in gastric cancer by regulating CASP3. Zhu CY, Meng FQ, Liu J. Eur Rev Med Pharmacol Sci. 2019 Sep;23(18):7968-7977.

  • Long noncoding RNA TUG1 regulates the development of oral squamous cell carcinoma through sponging miR-524-5p to mediate DLX1 expression as a competitive endogenous RNA. Liu S, Liu LH, Hu WW, Wang M. J Cell Physiol. 2019 Nov;234(11):20206-20216.

  • MicroRNA-524-5p suppresses the progression of papillary thyroid carcinoma cells via targeting on FOXE1 and ITGA3 in cell autophagy and cycling pathways. Liu H, Chen X, Lin T, Chen X, Yan J, Jiang S. J Cell Physiol. 2019 Aug;234(10):18382-18391.

  • miR-524-5p of the primate-specific C19MC miRNA cluster targets TP53IPN1- and EMT-associated genes to regulate cellular reprogramming. Nguyen PNN, Choo KB, Huang CJ, Sugii S, Cheong SK, Kamarul T. Stem Cell Res Ther. 2017 Sep 29;8(1):214.

  • EGFR/c-myc axis regulates TGFβ/Hippo/Notch pathway via epigenetic silencing miR-524 in gliomas. Zhao K, Wang Q, Wang Y, Huang K, Yang C, Li Y, Yi K, Kang C. Cancer Lett. 2017 Oct 10;406:12-21.

  • MicroRNA-524-5p Functions as a Tumor Suppressor in a Human Pituitary Tumor-Derived Cell Line. Zhen W, Qiu D, Zhiyong C, Xin W, Mengyao J, Dimin Z, Chonghui H, Haijun W, Yonghong Z. Horm Metab Res. 2017 Jul;49(7):550-557.

    • There are 27 references associated with hsa-miR-524-5p. Click here to see the complete list in PubMed.