Mature miRNA: hsa-miR-520e-5p

Mature miRNA

miRNA Name hsa-miR-520e-5p
miRNA Sequence 5' - cucaagauggaagcaguuucug - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0037324

Precursor miRNA

Precursor Name hsa-mir-520e
Genomic Location chr19:53675711-53675797 (+); nearby genomic features
Clustered miRNAs hsa-mir-512-1,hsa-mir-512-2,hsa-mir-1323,hsa-mir-498,hsa-mir-520e,hsa-mir-515-1,hsa-mir-519e,hsa-mir-520f,hsa-mir-515-2 (within 10kb in genome)
NCBI GENE ID 574461
miRBase ID MI0003143
Precursor Sequence 
    cu  u             u       g     guug   g
ucuc  gc gugacccucaaga ggaagca uuucu    ucu a
||||  || ||||||||||||| ||||||| |||||    ||| 
agag  ug cauugggaguuuu ccuucgu aaaga    agg a
    uu  u             u       g     ---a   a

References

  • LncRNA ZFAS1 contributes to osteosarcoma progression via miR-520b and miR-520e-mediated inhibition of RHOC signaling. Liu X, Wang M, Zhang L, Huang L. Clinics (Sao Paulo). 2022 Dec 3;78:100143.

  • MicroRNA-520e restricts the proliferation and invasion of glioma cells through the downregulation of Wnt/β-catenin signaling by targeting fibroblast growth factor 19. Zhang L, Cao Y, Jia D, Wei M. Biochem Biophys Res Commun. 2019 Apr 9;511(3):619-625.

  • Influence of miR-520e-mediated MAPK signalling pathway on HBV replication and regulation of hepatocellular carcinoma cells via targeting EphA2. Tian JH, Liu WD, Zhang ZY, Tang LH, Li D, Tian ZJ, Lin SW, Li YJ. J Viral Hepat. 2019 Apr;26(4):496-505.

  • MicroRNA-520e suppresses non-small-cell lung cancer cell growth by targeting Zbtb7a-mediated Wnt signaling pathway. Zhijun Z, Jingkang H. Biochem Biophys Res Commun. 2017 Apr 22;486(1):49-56.

  • MiR-520b/e Regulates Proliferation and Migration by Simultaneously Targeting EGFR in Gastric Cancer. Li S, Zhang H, Ning T, Wang X, Liu R, Yang H, Han Y, Deng T, Zhou L, Zhang L, Bai M, Wang X, Ge S, Ying G, Ba Y. Cell Physiol Biochem. 2016;40(6):1303-1315.

  • Selective microRNA-Offset RNA expression in human embryonic stem cells. Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O. PLoS One. 2015 Mar 30;10(3):e0116668.

  • miRNA and protein expression profiles of visceral adipose tissue reveal miR-141/YWHAG and miR-520e/RAB11A as two potential miRNA/protein target pairs associated with severe obesity. Capobianco V, Nardelli C, Ferrigno M, Iaffaldano L, Pilone V, Forestieri P, Zambrano N, Sacchetti L. J Proteome Res. 2012 Jun 1;11(6):3358-69.

  • MicroRNA-520e suppresses growth of hepatoma cells by targeting the NF-κB-inducing kinase (NIK). Zhang S, Shan C, Kong G, Du Y, Ye L, Zhang X. Oncogene. 2012 Aug 2;31(31):3607-20.

  • miRNA-520b and miR-520e sensitize breast cancer cells to complement attack via directly targeting 3'UTR of CD46. Cui W, Zhang Y, Hu N, Shan C, Zhang S, Zhang W, Zhang X, Ye L. Cancer Biol Ther. 2010 Aug 1;10(3):232-41.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

  • Identification of hundreds of conserved and nonconserved human microRNAs. Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z. Nat Genet. 2005 Jul;37(7):766-70.